Cavia_porcellus Locus Mono:9:SNORA1
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:9:SNORA1
Cavia_porcellus
Mono:9:SNORA1
scaffold_234770
SNORA1
1001..1131
1226
TCAAAAAATCACCTGGAGAAAAAAAAGAACTATTGCAAAGAGCCTAAACACAATTAGAG
AATATATTTTAAAAGAAGCACAGCACTCTCCCCTTTTAAATTGAAAATCCAAAATAGGCA
TTGTTGATTGGTGCCCAAAATTAGTTTATGTGCCTAAAATTGAGACACAGGTCATGGTTC
TATCACAATAAATGTTTACAGGAGTGACAATGAGACCTGTAACATTTTGCCTAATAATGA
AAAATATTGATTTTCAATATTATACATGAATGGTTAATAATATAAAATCTAGAATATGTG
ACAAAGTACCAACAAAACAAACATAGAACATAAAAATCTTTGGGAAAAAAAATCCCATGA
AAATTTTTACTACAAATGGGTTGTGCATTTGTTCAAAGTTCAAATTCAACAAATAGCAAG
TAACAGTAAGTTTGAGATAGAAATTCCACAATTCCAAAACTGAAATATTCCATGAATTTT
TAAATAATGAGGAATATAAGCATGAAGCAAAGGTAAATTTACTTTCAATGGTGAAGCAAC
TTGAATCATACCAAATAATATTTGGTGTGATTAGAGATTCTTCATTCATTTTCTGTTTAC
ATTAGAAATAGACATTAATATATGTCAGTGGGCTATCATTGGATGCATCTGTCTCCTCCA
AGGAAGGACCAAAAACTGATGATATTTTAAACTATAAGTTTCTAAAGGAAAAGTACTGAA
ATACTTGAAAGAAAAAATTTTGAATTCCATTTGGAAATTTCATCTCTGTACAGATGTGCG
TTTGACAGAGCAGTCATATACACTAACCAAAGAAGACTCATTATGCAAAAATTCACTGTT
ATGGAAGTAATCGCTTAGGCACATGCATCTTTAAAATATAGTGTGTATCTTCTATCCTGT
AGAAAATTAGTATTGCTCTAGCTCAAGAACCATAAAAATTAAACAGATTAACAAAGATAG
CAAATTAGGAAGCCTCCTGCTCACATCCTCCCATAGCAACAAGAATTTGGCAACCATCAT
TGGACAAAAGTGCCACCATGCAGCTTTGGCACCCAGGTAGATGTGTGACACGCACTGGTA
GACCCTCCAATGGCTGTTTTAAAAGGGAAGACCACTCGGTGACAGTGTTGTCAACTGTGG
TCCAGGATATAGGCCCAGAAGTAGCCTTGTTTTCCTATAAATTTAGTCTTAATCCCACTT
AGGCCTTGGTCTTTCACCAGAAGCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved