Cavia_porcellus Locus Poly:11:SNORD22
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:11:SNORD22
Cavia_porcellus
Poly:11:SNORD22
scaffold_78925
SNORD29, SNORD30, SNORD31, SNORD22
1001..1065, 1301..1370, 1587..1658, 1971..2096
2173
GTTCCCTGTATGACTGGGAATTGCCTGCCATTCAGGTGCAGTTGAGGATTTTGGTTTTT
GTCTAACCAAGTAGCCAGTTTCCATGATGAATTTAACTAGCTCACTATGACTAACTATGA
AAACACATGAACACCTGAGAAACTGGGGTATGACAATGAAGAATGACAAGGGTTATGAAG
AACCATGTAAAAAACCAGTTTTGTCTTTTCTCAGGAAAATTACCTGTATTCATCCTGGGT
AGTAACTGAATTCCTCAGGACCAGTTATGAAAAGACAAAGTAGGGTGTCCCCAGCACCCT
ACATGATTCAAAGGTGAGTGATTTTGGTGTATGTTCGGTGTGTGCCAAATATTGGGTAAG
AGAAGTGCCTCTTTGGGGCTGTGTGATGACTTACATGGAATCTCGTTCGGCTGAAGGCTT
GCTGTTGAGACTTGGAAATCTGATTTCTCCAAGGATAATAGTTAAGGTCACTGTACAGCA
TGTAAGCATTACTGACTTGCATAATCTTGTGCATTTCAGATCCAGCATCATATTTGGAGG
CTAGGAATGATTTCAGGTGAGATCTTTATAATGCTGCCCATACAAAACCTGATTTCTTGT
GTGGGGTGTGGTGGGCACTTCTGGGCCTCATGCCCAACTTTGAACGAATAATGGGAGTAT
ACTGCTCACCAGGGATGAAATTGAATACCGCCCCCAGTCTGATCACTGTGACAGAAAAGG
TATTTTCTGAGTTGAGCTTACTTCAATAACAGAAAGTTAACAAATAAGGTTGTAATCAGT
AATTTAGGGAGCTAGGCAATGATTTATATATGTATCCCTTGAAATCAACACTGAGACTTT
ACTCACAATCTCTTTACAGAAAAAGTTAACCATGCTTTTCAAAACGAGATCTCCCTATGC
CATACAAACAAGCCTTGACTTCATGACAATCCTGCTTCAGTCTCCAGAGTGGGATAACGG
GCAGTGCCACCATTCCCAGCTGCAACCCATTTTTCTTTGCTCTAAGGTGAGAGGTGAATG
TACATACAAGGTGAATTAAGCTAAAATTTCCCAGTGATGAAATAGTCACGAGTCTTACTT
CCTGTCCTAGTCCCAGAGCCTGTAAAGGTGAACCCACTGGGGCTGGCTGGGGGAAAAGAG
GAAAATTAGTTCTAGAAGGAACTGTCTGAGGGATCATCAAATTTTCTTAATACAATGAAA
GAAAGATTCCTCAGTTGCTGAAATGTGGTTGGTTTCTATTTTTTCCAGGTCTCTGGAAAA
TACAGTATATACAAATGGTAGGTGTCTGTTCAAACTTCAGTCTTAATCAGTGCTGGCCTA
GAAGTAGACATTTTGTTGATTGATCTAAAGCATAGCCCCTAGTGAACCGGATTATAAACA
TTCTCCCACCATCCCCCCAGTAGTCAATGAGCTTTTTTTCCTTCTCTGCAGGTGTCCCAA
GTCTTGGAAACAAAATTTCTCCCTGGCTGTTGAACTTGGCATATAGTTAGTCTCACTAAT
AAAATTTTGCTCAACATTCCTGTGTGGTCTTTGCTTTGGGGTGGTTCCACATAGGCACTG
ACTTGGGATTGAACTCCAATAGTTTACTCCTGAGCTTTGTCAAACTTGGCATAGCAATTT
GTAGTGGTTCCCTTTCCCAGTCCCCAGGAGTATCAGCATGATGTGGCAGTAAAATAACCT
GTTATCACCTGCACATGTTGCCTGATTGGATTTTTTTGTAAATGAGAATAGCCCAAGGAC
AGTAGCGCTGAGCCTATCTTTGAACTCACCACATTGCACTTGCCAGGCAGGGTACTTACG
CCACTGAGCTAAATCCCCAGGCCCTTGAGCCCATCTTTTGAGGGGGAGATTCAACTCAAG
ACTTGACAGGTCTGTCTCAGTGGGATATGGGCTATGGATTAGTCTTCATCCTCCACCCCC
AGGATAGGGACTGTGTCAAAGCCAGTACTCCAGTCTTGCTATCTCATTCCTTGTGTTTAT
GGCTGGAATGTCTGCAGCCTAGCAAACTATGCCTAACCCAAAAGACAAGGCCCAGGAATT
TAGCTCGGCAGAAGTACCTGCCTGGCAAGCCCTAGGTTGTGAATTCAATCCCCAGTACCA
AAAAAGCCATTGTGGGCTCAATCGTTTGGTGCCCTTGTGGAGAAAAGTACACCAGTGAGA
GACTTTTTTTATGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved