Cavia_porcellus Locus Mono:349:SNORA11
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:349:SNORA11
Cavia_porcellus
Mono:349:SNORA11
scaffold_280673
SNORA11
1001..1126
2126
ATTTTAGTTCACCCTTTAGATCTGTTGATTTAAGCTTTTCTGGTTTATTCAACATGGAT
TTTTTTGCCTTTGGAGATGGTAAAAAGTGCAGTAAAAGGCAGATATGCACATTTAAGGTT
TCTACCAAATAACTTAGCAATCAAAGTTGCTGCTGAGGACCCTGAAGTCCAGGGATGTGA
CTTCACTGTATCATTCCACTCCCAGAGACGTTACAACCTGCCTTCCCTTCTCAGCGCTCC
GTAAGCATCCAGGTTGCTAAGCTGCTGTGACACGTGACATTTGCCTTCCTTTCTCAATTT
CTTTTTTCCTTCTAAATTCAGAACATTTTTAGCAGACAATTGTAAATTCATTATCTCTTT
CAATACTAATATGAAAAATGCTTAAGTGACCACTCAGTTTTAGAAGTTTAGAAATACAAA
TACTGTTAGACTTTCAGAGTGTTTTTTTAAAAAAATATTTATTTATTTATTTAGAGGCAG
GGTTTTGATAGAGTGGTTTACAATAATTAAAGGTACTCTGTGGTGGTTTTTTCTTTTCTT
TTTTTGCATTAGAATCAGTGTACTGGGAGTGTACATTCTGAAAGTGAAGGTTTCTTAAAA
GTGACTCAAATGGTAATAATGCTTCATTTCTCTTCAAGTTCTGACTGAAAGATTTAAAAA
ATCAATTAATTTTTTTTAGGACCTTGCTATGTAGTTTTGGCTGGCCTTGAACTCACTATG
TAGCCTAGGCTGGCCTCAAACTCCTGGTGATCTTCCTGCCTGAGCCTTCTGTGCTGAATT
ACAGGCAGGCAGTACTATGCTGGCTCTTTTCGCCTTCTTCTTTTTTTTGAGACAGTGTTG
CTGTACAGTTAAGGCTGACCATGAACTCTCTATGTAGCCTTGCAGTGATACTCTTGCTTC
AGCTTCCTGAGAACTGGGATTACAGGCATGTGCCACCATACCCAGCTCAAGATTTCGTTT
TTAAAGAAATGAGTATTAGCGTTAAAAGCATCTGTGTAAGTTGGGTGTGCTCAGAGCTGG
GGCCTGAAGAATGGCTCTTCGGTTTAAAACACTCCCAATAGGAACCTGAGGTCACTGTGA
AGAGGGCATAAAATGTGTGTCCTACTATCAACAGACACCTTACAGACAGCAGGCCAGGCT
GGGGTGTGGGGAGGTGGTGTATGCCTGCAGTGCCAATGTTCTGGGCACTGAGGCTGGAGG
ATTGCAAGTTCAAGTGCAGACTGGGCCACTGTGTGACTTAATGAGACACTATCTCAAAAT
TAAAAACAAATTATGTATATATGTGTACGTCGGGGCATGTAGATCAGTATGAAAACCCTT
ACATTCAATGCCCAGTTCTGCAAATAAAACAATGCAAAGTGAACCAAACCAAACCAAACC
AAACGAAACCTGATATCCCAGCACTCAGTGGGCTGAGGTAGGAGCATTTTGAGATTGAGG
CTAGCCTGGGCAATTTGTAAATTCAGGGCTGGCCTGCACTATACAACAAGACTTTGTCTA
GAAACAAAACCAAAACCAAACCAGGGACAAGAAAATTGTATAATTTGGCATAATCAGACA
AAGCACTATTGTCTTTGTGTCAAACGAAGGACGAATCAGGTGTATTAATTCCCAAGCCCT
TTTCTAACTACAAAACAAAAGAAAATTTTAGGCCACGGTCCCAGAGTGTGGCTTACTGTT
ACAGGACCTGCTAAGCAGAAGCTGTGGTTCGATTCCCTTACCATGAAAAATAAAATGAAA
AAGAAATTCAGACCACCCTTGGATGTTATCTCCTTTATCGAACCTGTGTTCTGTGATGAA
CCAGCAACCAGAGCAATTTTAGCTGTGAACAGCAGGTGGGGCAAGTAGCCCAGCATTTTC
CGGGTGGGGAAATACTCATTTCATACTTCAGTTGTTGACTGAACAACCTGTTTTCCTGGA
GGAGCCATCCAGAGAATGAGATTGCTTCTTAACCTCTTAAACCTGGGCCCTCTTAAAAAA
GAGGGCTTTTCTTATGGTCAATAAGAAACATATTCACTTTACTCCTTAAAATATTCACAT
ATCTAAGCGCTTTAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved