Cavia_porcellus Locus Mono:404:SNORD49
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:404:SNORD49
Cavia_porcellus
Mono:404:SNORD49
scaffold_171527
SNORD49
1001..1073
2073
GTCCCTGGTGGACAATAATTAACTGAGAAAGCTTGAGGATTATACGTGATGCTCCTGAG
TTCACACAGGTAAACAGGTAATTGTTCAGGTAGTTGTACCTGCAACTGTCATAGGCCCAC
CTCAGTTTCTAGGAGACCAGGATCTTTCATAAGGTACCATTCAGCAGATAGAATCACTCA
TCCCGGCACTAAAAAAAGAAACATTGTTTTCCTAGCCCAGGGACCACCACTACTGATCAG
CAGATAAAGGATAATAGAGTCTTTTAAGCACTGATTTCCGGACCGGTGTGCTTGTTGGTA
CTGTGCCATCTTCCTTGGTTTAGGAGCCAGAAAAAAGCCACAATATGCAAGAGCTCCATT
CCCAGAGTCATTCCTGTTGACAAGTTATCAATCCATGTCGAAAAAGGGTACAAATTCCCT
GTTCCCTGACCAGCCTGGGACAGCACAACCTTGGAACCTTGGAACCTGGTTCACACAGCC
TGCAAAGGGAAGGAAAATCAAAGAGGGTGGTCCAAATAACCACCAGCTGATGCAAACGAC
CCATGCCTTGGACAGCTCTGAGACAAGAAAACAACCAGAGGTGTTTGGGACAGTGCCCAG
GTTGCTTTGGGGAGATGATCATGGCATGAGATTTCCCAACCTGGGCTTTTGTGATGGAAT
CTGTGGGTTCTCCTACGTTCTCTCCTTAGTTCCGAGCTCTTCACAATTTTATTTTGAGGA
ATGCCTGTTTAGCAAGTTTTCTCCTGATGGCAATTCTGGGAAAGTAATTCTTGTCAAGCA
CTCTGATTACAGATCTTGCAAAGGATGTTTAAGTTTGTGTGGCTTCTTTCCCTTGATGCC
TGAACCAAGTTTTGTCCTGTTCCTGGATATATTTTTCAAATTAGCATTTAAACTTCCATT
GTCTCTATCTTGATCTGTAATTCTAAAGCCAAATCACTTTGAAAGCCAAATCACTAAGAA
AATTTAAAATATCAAAACATACATTTTAAATGGTTATTGGGTGCTCTGATGATTACTAGT
AATAGGAAATGCCATCAGAAGTAATAACTGACAATATTTATACTTGATCTGACTACAGTC
ACTAAAATCAACAGATTAGTTGAATGTTACCACCAGATTCTATTCCAAATTCTTGTTCTT
AATCCATGTTTCAGATGTTGGACTCAAGTACAGAATACTGGAGACAGGAGCAGCACCCTA
CCATGACGTTGGGTTGCAAATTGGCAGAGGATACCAGCAGCTTCGTACCGCAGGCCTCTT
GAGCTGCCTGTGAGGCCTGCTGTACATTCCGCTAGCCAGCTTCCACTCAAAGCCTACTAG
CATACTGACCTCGGATCAGGTTTTGGGAAGAGTGCTGCAGCGTGGCTTTAGATCTAACAG
CAGTGCAGCTCAGAAGGAGATCAAGGATCCAAAGGTGCCATCCATTCAGCTTGAGAACCT
AAATAACTTGAATGTCTGGTACAGAAGAAACAAGCTGCATACCTCCTGTATCAGAGGCCT
TTCTTCTCAACAAGAACTGATGTATCTGGCAACTTTTTCTAGGACAGACAAATTGAGTGT
CATTCTGCAGAATTTAGGACCAGAACAAATGGAGACATGGCACCAGAGGAACTTTACAAG
GCAACTTTATTACTATAGTGGGCTAACAGGAACTTCAGCTCCAAATCATCAGCCATGATT
GGAAGCTTTCTAATCATTTAAATGTCTTCAAAAGGCAAATAACATAATATCCTACAGTTG
GTTTATATGTCTTTGTCATCAATTTTTAGGCAAAATTTACTCTTACAGATACTAAATGAG
GTTTCTATTGTACAGCATAATGCAAAACTCAATCATTGTTTGAGACCAAGCAGAGAGGTC
CTTGCAGTGATAACTCCAAAGCCTGGAAGCACAGAGACATTCCTTCCTGGCTGAGCTGCT
CTTATCTTGCAGTTGGCACCTGGACTGTCAAGGCTTGTCAAGTTTGTAGCTTTTTAACCA
TGGGAACAGGCTGTCTCCTGGTCTCATCTTTGAACATTGTTAGAAATAGGCTTATTATTA
GAAATGAGTTTTAAAATTTTCTCTGCATTAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved