Cavia_porcellus Locus Poly:22:SNORD44
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:22:SNORD44
Cavia_porcellus
Poly:22:SNORD44
GeneScaffold_6929
SNORD74, SNORD75, SNORD24, SNORD77, SNORD44
1510..1587, 2001..2065, 2207..2288, 2500..2567, 2836..2897
4001
ctgtattacactgcttgcaaagaatccaaacgtagccattctgaccttttttcaaagcg
ttttgttttgaaacttttattccagtaaagaagtctcctgttcgttgccatcatgcattc
agatgtgttttattttggagcctacaccagccgccttttttgtttgcctctttccggcaa
ttcccccagtgagggaaggaaagcccttggagtaaagttctctcttctaccgtccggcac
tgggcatgggtgacaagctgtaagagggaagaaacccgggaacccgcatgggggttgggc
cactctgggtaccccgagccagcttttcgcctcccgtgaggaaagctggggggaacagga
aaactggcccgaggaggcgcactgtccaccaaggaaacttggcaccacggggtgcaaatt
tgaaggcccgcaccggcgagcgcaaaaggtgagcgcgaagggctgggaagggggcggcgc
ccccgggagcgggagcgcggcggcaggcgcccgcgaggagccgccccgaggtgggtgtgt
gtatctgggtgtgtccctcgcggcggggagggggccgcccagcccggggccgtgaggggg
cgggtcccgcagcgccgccccgggccgggccaaaaaagtggaaggtcgctgagtgcctgg
agcagaggcgggggcaaagcggctgagcgccctgggagcgggctgtggcggagacagggc
gaggtggccgcgggacagggcagcagaaccgggggtgcggggcccgagcccagtcaaaga
acggtacctacctccgggggtggaaatgggccggaatgggccggaacaccgtcccggaag
tgaaaccccccgcccccacccccggagcgggcgacgtgccggaaggaaatcactcaccct
cacaccgcccctccccctcccccaccgctttcggtcctgtgctcgcgccccctccccttg
gctcttgctgctccctccagaggagcgcaagagccctgcgtcacgctggcgactttgttc
ccgcccacaagggggaggtgggcgggacatggagccgagtgtgggggcgggaggaatttg
aggaaagaaatgaggatcgggaagggcgcctgagagaagcgtgcgccgtgacgtcacgaa
acgttcgtatataaacggcgacaggcgccatctcgttctttcagcggcttgacttggtct
gcggtggcttgcggaagttaacttgggctttgtcgtgtttacgatcttgctcttttcctc
tttggaggcgaacttgtggcctttaatatatgaaaggcaagctttctggcgctgagccat
tttgtctttgggtttggtgaatcgtcttgatttttgggatcttggcctcttttttgaggt
cacgtaaaacttgtgtttctaggtcagtctcttgtagggatcaagataggggagttctgc
gttgggtgccgacgcaatcttaattaactgtgagggttgttggagcgcagctacggaggt
ttgggctcgcGTGCCTTGCTCATGATGAAGCCTGTGTTGGTAGGGACATCTGAGTGCTGA
TGAATGCCAACGGCTCTGATGGCGGCGCatgcagagtcacccgagttttcctaacctaga
cctgatctatttgcttgagctcggaaggtcttgtggagcccacgtgtatctctagtaact
gcattccgcagtgcagcatttattaggctccagggttggttcttaactgattcaaatact
gttcagttatactgtctgaaggggctagaaatcgtgtatgttcgctaagtgctccctcgc
tgagctgacctctgatggaagttgtgggtcgtatgagctagctgcatatgtgatagaaga
aataaggctattagtttagcaggttaaatgcctatctatattttcattaggaatgatgct
gtacgggaggaatgtggcgtttgatggcattatatggccaggtaagaaagtgaaatgtgg
agagaaatagttcttgccttaAGCCTGTGATGCTTAATACAGAGTAGTGGACAGAAGGGA
TTTCTGAAACGTTTGCTTCTGAGGCTttgagacttacaaagaggtattaatttttgatct
gaagacgctcattttttgttttttgttttctagttaagtgccaaggaaagatgagaactc
aagtaagttttagtttcctcatgagggaaataagggggaaaaacaagTGCCACAATGATG
ACATTATATTTGCTACTCTTGACTGTCAGAATGACGATAATCTTAACCACCATTATCCTA
ACTGAGGCAcagaaaacacagatttggggaacgtagcaatgtcacttaagttcactaagc
tgttttattctaggtcctaaacaacaagcctccatccctggggatagaggtgagaaagtt
ttcagtcactgttgatgcagtactgtgctcagcttaattgtataatcttgccttgttttg
atgactaaaaagttaactggtagagaggatgaataaacagATACTATGATGGTTGCATAG
TTCAGCAGATAAATCATGAAGAGATTTACCCATTTGTCTGATGTATCTgggattgatgag
ttttgtaccacttagtattaaaagttattttctaatgtatttaaattttttcataggtat
cggaaagccagaagttaaaatggtgagtgaaattacccaacttgaacatggatgacaggg
caaactactaaaggcacaaaataatgacattttaggggagtgtattttaacgtagttggc
agctttactgtggctcctgagtgcttgagaaaaatgcagtttcttgtcctgtaactattt
gtaagactaaatgcacCCTGGATGATGATAAGCAAATACTGACTGAACTATGAAGGTCTC
AATTAGCTCTAACTGATCttgggcattgttagttttgtagggagaaaatttgtctttggc
tattctaagccccattctttcttcataggtggagtttgacttaactggaccagctttact
tgagtaagtgtttggaaactttagattgaaaactgtatgcttaagtggcatgctttctga
ctggtttaataactcctgtttgataatggatgttgatttaactatttactgagcatgctc
tgtatggggtttttgtaatgatgttgatcaaatgtctgacctgaaaacgagcatgtggac
aaatttaacgctgaataaccctatgacaaataatgaagagaaataaaatggtttttagca
tgttaatgagaattgtcctgtttttattctagataattattacacatctggatgacttgc
tttggtaaggaaataaaaagaaaatggttctgttttcccaatatacaatacttagaggtc
tgatctttactgtagctaataataatctttgacactgattccagttcctattcagtataa
tagaaagctattaaaacagtgagtgaatctgttagccttttcaaagttagtattggactg
ttacgaaatggtatctaaaactaaacttgtttttcaggtccagattatgaagatttttat
aaaggtatacacattttaatttaattacttaaccaggtaacccaagattctgttagtgat
gaagtttaaatagatgggaatctctctgagagagaatgaagcttaatttcaaactgaaac
agtaattgggaaatcttttaggaaaatcacctctgaacatcatctttaattaaactgaaa
tttttcaggtactctgagtcaccttggctatgatgcagtgcaagcagtgtacagaaaggt
tagcaaatttctgttggggattcaacccagggtaatgctgctgggtgagtgctctactac
tgagctacacctgtagccctcaagcctcactaagtcatctgaaagccaatacagtgatga
taacatagttcagcagactaatgctgatgaacaatcacaagtctttcgctcctatctgat
gtatctggctgcaacaatccaactttagcctacaaatttaac
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved