Cavia_porcellus Locus Mono:603:SNORD18
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:603:SNORD18
Cavia_porcellus
Mono:603:SNORD18
GeneScaffold_5844
SNORD18
1001..1069
2069
CCAACCAGTACCTGGCGTCGCTGGCACCGCAGAGTGAACACAACTCAAAAGCGGTACGC
CATCTGCTCGCCCCTGGCTGCCTCGGCTTTACCAGCACTGGTCATGTCAAAAGGTTGGTG
ATGGTTTTTCTGCATCAGAGTAGTGATTTCATCCCATGGTGTCCTGCTGTAAAGTGCCTA
TCACTAGCAAGGAATGTAGCTTAAAGCGAAATTCTTCCTTTTAAACTCCCCTTATGTTTC
TTGTGGCATTTTTAAACTGAAAATGATGAAATTCCACATATTGGTCCGTGTTTCTGAAAC
ACATGATATTTGTGGAAATTCTGATATAGTAAATCGCATGTCATTTTGCTTTTGTGGGTT
ATTGCTCAAGTGTTAAGTTTTTCAAAAACATTCAGATAACGAGGTCAGTCTTCAATTGAC
TTTATCAGGTCATCGAATTGAGGAAGTTCCTGAACTTCCTTTGGTGGTGGAAGATAAAGT
TGAAGGTTACAAGAAGACTAAAGAGGCAGTTTTGCTTCTGAAGAAACTTAAGGCCTGGAA
TGATATCAAAAAGGTAGGTCCTTGTGCATATTTACAGTTGGGTAGGTTATGCTGTACCGT
CTAGAGAATAATGGCAAGAAAAAAAGGTATACACATCCATTACAGACATGGTGCTTTTCA
GAGTGTCTCTTTTGTAGATTTGGTTAGTTGGCTTGGGAGTGTAGAACTAGCAGATAGAGG
ACAGCTCAGCATAGCGTGCAATAGTGAGAGCTTTTTAACCAATCTCAACTTGGTTCAACT
GCTGAGATCAGCCCCTAATATCAGAGCTACTGGCTTTGTAGGTCTACGCCTCTCAGCGAA
TGCGGGCTGGCAAGGGCAAGATGAGAAACCGCCGCCGGATCCAGCGCAAAGGCCCCTGCA
TCATCTATAATGAAGACAACGGTATCATCAAGGCCTTCAGAAACATCGCGCGTGAGTCTT
CCCACTTGTGTTGCTTCTCTGTATGGTGCTCACACACTCAGCCTTGATGATGAGTACCAC
TTCATGGGACGTGTTTCTGAATTCGATGACATTGCGGACAATCTGACCTTGTGTGAACGA
AATAGCTTGATCATTCTATTTTGAAACTTCACACATCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved