Cavia_porcellus Locus Poly:26:SNORA63
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:26:SNORA63
Cavia_porcellus
Poly:26:SNORA63
GeneScaffold_5121
SNORA63, SNORA63
1001..1129, 1141..1252
2252
AGCCTGTGTTGGTCAGATGTGGCTTTCTGGTAAACACCAGAATAAGTGAAAGATAAGCC
TCACCTGGATTTCAGTGGGAAGAGGCCATGCATATCTTGCTTTGCCTCAGACACACAGGG
CAGTGCTTTGCCTGCGTCAAACTCTTACCTGACTCCAGACCCGTGCAACACAGAAAGTAT
TCTCCAGCGCTTCAGTGATGCATCACCCTCGGTGTGTCATGCCTGACATGTCAAGCATGG
GTGCACTACTTATTTCTCTTACAGAAGGTGTGGATAAGTCTTGCATTAACATGGTAACCT
GCAAGGCATGGTGGCGCATATCTGGAGGATTCATATCTAGAGGCTGAGGCAGAAGGATCA
TCCTGCATTCAAAACAAGCTTGGACTATATAGGGAGATCCTGTCTCAAAAACAAGAAAAG
GGGAAAAGAAAAAAAGAGAAAGAAGAGAAGAGAAGAGAAGAGAAGAGAAATGTGCAGCCT
ACCTGTGATTTGGGCCCCTGGAGTAGGTCTGCATATGCACTAGAACAGGGTGGTAAGCAG
CAAGACATACTCTTCAACTAAAATAGTGCTTTTTAAAAAAATTTTCCCAGAAGATCTCAT
TCTGTTGACCAAGGTGGTCTTAACTCACTATGAGCCCAGGCTGGCCTGGAGCTTGCCGAC
CCTCAGTAACCACTCAGGTGCTGGAACTGCAGTGTGCACATGAACACCTAAGCTTGTGGG
GAAAGGTTTGGTCTTCTTAGATGGACAAGAACATTTTGTGTAGAGGGACTGACATTTTTA
AGGGTATAATACAGACATGGGTGTGATCCTTGGCCCTAGTTCCAAGCACAAGGCTCCTAA
GATTTTCCATATGTCCTGAGTGCCAGGGATGTCTTTTGTTAATCGACACAAGCCCCCTTC
AATCACATCTGAGTTTATGTTAATAAAGTGACCTAGGGTAGGAACCCTAGCTAGCCTCAC
CGGAAAGACCAAGTAATTGGACTGTTAGAACTTTCAGTCCCAAGCAGGATTCAGACTACA
ACATGGCTGTAAAGTGCTGTGGTGTCATTCCTCCTGCTCAAAATAAGCTTTTTTTTTTTT
TTTCTTTTGTCTTTTCATTTTTATTGGTACCAGGGATCGAACTCACAACCGCCTGCTTGC
AAGGCAGGTGCTTATCCCGCTGAGCTAAATCCCCAGCCCCAATAAACTTGTTTCTTAACT
ATACCTATCTGCCATGCCTGTGTAGCAGCCAGGGGACGCTTGGTCTCATACATGGTAGAA
AAAATAAATAAATAGCAAAAAACTTTTCAGTCCCCCCCATCTAGGATCGAAAAAATGAAA
AAATTTTAAAAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCATAAGTGCCTGCCTTGCAAGCAAGG
CAGTCATGAGTTCGATCCCTGGTACCATAAAAAAAAGACATAAATAAATAAATAAACAGA
TGGTCTGGTTAGCATGGAAGGTGAAAATGTTGTTTCTATATATGATGTATTTGTTATCCA
TTGCTGGGTAGCGAACTAGCCTAAAACACTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved