Cavia_porcellus Locus Mono:566:SNORD17
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:566:SNORD17
Cavia_porcellus
Mono:566:SNORD17
GeneScaffold_2781
SNORD17
1001..1199
2199
ACACATGGTCCCTGAGTACCTTGGAGGTCTGGAGGGTGGCACCAGGGGCACTGGTGGGT
GTGAGATCTGACCCCCGAGTTGTGATTCTGAAAAGCCCCAGGCTTCTCAGATTGTGAATG
TGCCTTTCCTCTTGGGAGCCTTGACCGAATCTCTTGGTCTGAACTCTCTTCAGTGGGTTC
TGTGGGTTTGGGCAGGTGTAGTCTCCACTGCTTGCCTCCATGGTTCTTGGGCGTAGTCTT
CCAGGTGCTGGAACAGGAGGGGCCTGCAGTTTGTTCAGGGTCGTCCTGCACTTTGCCCAG
TGCTGCTCCATACTTAACCAGTTGTGAAGTTTGCAGATTTTTTCAGCACATTCATGTGAC
TTCTCTTTTCTTTATATTCAGGAAGTTCAGCTTATCGCATCTACCCACACTTAGTTCTGG
ATGAGTGATTGCACACACTGTCCTTGGTCCATGTTTGCGACTGCTTATCAGGTCAAGATG
TGCTCAGTCTTTCTGATTACAGGAAGCAGTGGGCAACAGGCTCCTAGAGAATTTTCTGGA
TCTGCCTGCTTGCTCAACACCTCGTGACTGATCACCCTTAGTTTAAGCTAGGCGTTTGCA
ACTTGGGCACTGCTGTTGCTCCCACAGTCTTGGGGAAGTGGCCCTAGGCCAGTAGGTGTT
CGGCAACATTCCCAGCCTCTCCCTGTGACAGCAGCCTCCTGCCCTCCAGGCCTGACATTG
CAGAATACCTGCAGGTGCAGCCAGGTAACCCCAGGACTGGGTCAGGCTGCCCCTGGGGCC
CTACTGGCTGGTGACAAGGTTTTTCCCTTTTAGTGGTTGGTGTTTTCTGTAGCCTTCTGC
TGGTTTTCCATTAGGATTTCTGAGTTAGGAGAACCTTAGAGATGGTGCAGCTTTGCAAAC
TGATGTGGAAATTGTTGACACCTGATAATCAAGTGATTCTCTTGACATGAGTGAGTTATT
TAATGCAGTAACACAAGGTCTTTTGCAGGGCTCACAGCTTTGTGAAGTGATGATTCAGTT
TATCCATTCGCTGAGTGCACCCCACTACCTTCTTCAAGCCCCGTTCCTGTTCTAGGGACT
CAGGGCTCTGCGGCCCCCAGTGCCTTGCGGCCTGCAGCGTTCTGCTGCAGGTGCGTGGTG
CAGGGGGCTGTGGGAGGGTGGACGGAGGCAGCACGAAGATGAGTGGTGGAATCTGATCAC
TTGCTGTGGCCCTTGTGCTTTCTGTTGAGCTTGTGCCTCTTCCATGGTTGTTGCCTGTTA
GTGGTCTGAGGTCAGAGCCTTGCACTGGTAACTCTGAGGACACAGGTAGCCTTGGTTATA
GGAAGATATAGCCAGTGAGGGCAGGGATGAGACCCAGTGACCTGCTGGAGCTGGGTGCAC
TTCTCATGTACCATTGCCACAGCAAGGTGTCAGGAGACTAAGTGGTGGGAAAAACAGCAA
TATTCATAGACGGTACTAAAACATTTTAGCTTTTTGTGTGTGTGTATGTGTACTTGAAGC
TGGCCTCGAGCTCCTGGAGATCCTCCTGCCATAGCCTCCCCAGTGTTGGGATTTACAGAA
CTGTGTGCAAAGAGCTGACAGTCCAGCCATAGTCTAGGAACAGGTTATTTGGAGCTTGCT
TTTGTCCTTGCAGGTGTGTGGCACCAGGCTAGGCCAGTGTCTGGGTTCCGAATTGCAATC
TTGGCTTCTGTGTTGTCTGGTTAGCCAATGAACAGAATCAAGTGAGATTTGGGCACAGAG
TAGGTGCTGGCCCGGGTCAGTAGCAGCAGCAGCTGAGGCCAACAGGTATCTTCAGCTGTT
GCCTGATGCTGGACTGGAAGTGCACTGCCTCTTCCCCAAACCAGCTGGATCCAGGCTTTC
TAAGCGCAGCAGCACTACACTCCTCTATTTTTCCTGCAGTGAGAAAGCAGTCTGAGACAC
GGGGTGTGGGCTGTGGGGATCTCTTAAGGAAGTCTGCAGGAGTCAGATATCAACCAAATT
CCATGATTCTCTGCAGACTTGGGCAGGATGAGAGAGACAGGAGGACCGGAACTGAGGTGA
TCCTTCCCTGCTGGCTTAGATTAATAGTGGCCACTCAGGCAGGACAGTCAGGGGTCTGGG
TTGGCAGCAGAGCTGAGTAGTGGCCCACTCTGAGCAAGAGGAGCAAGACAGTGCCTCTGG
AGCCTGGTGACTTCTTTGTCAAGGACTGTACTGCAGAACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved