Cavia_porcellus Locus Mono:37:SNORA71
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:37:SNORA71
Cavia_porcellus
Mono:37:SNORA71
scaffold_270585
SNORA71
1001..1133
1628
AGTTTTGCACTGTACTCAGCTATACCCAGGTCTTAAGTCACTTTGTTTTCGCTTCCTAT
CTTTTGCCCTTTTTTTTAATCCTCACTTTCATCCACTAGAATGCAGGGATGTGATGACAC
AGTTTTTCTTTGGGTCATAATTTCCTGTCTTCTACAATTCAAGAACTACATCAGCTAGCT
AGCTAGCTTGCTTGCTTTGGTTTTTTGAGCCAGGGTCTTGCTGTGAGTGCAGGTTGCTGT
TGAACTCACTAGCCTAGGCTGGTCTCAGACCACAGCAGTCCTCCTGCCTCAGCTACCTCA
GTGATGGGATTACAAGCACACTGCGCTTTCCATCAGTTTTCTTTAGTGTCTTTCCTTTGC
CTCCCCTGTCTGGCCATGTTGAAGGAATGTTTGAAGAATTGGAAACCATTGTTGGGTCTT
TGTGTTTAGTTGGGCTGGCTGCTCAAAACTTGTGCCATTTGCCTCCTTTTACAGCAGTTC
TCCCGCCCTTTTCTATTCCTGCATTCGTAAGTGATCAGGGACCCCCATGCCCTGGGCATT
GGTAGTGCAGGTAGAGGAAATGTGGAAAGAATTGTCCTATGTTTGGAGGGTCTGCATGCT
TGCCTTTCATTTCTAGGCGCTTTCCCACACTTCTCATCATATAGCTTGGGCTTTCCGGCT
GTTTTGTGTGCATTACTGCCATTGCTAGGGGCTTTCACATCCTGCCCCCTGCTTTTATGT
GTTTCTTAAGTTCCTTCTTGGTGGTCAGCAGAGTCACTGCCACTCAACTAATCGGTGTTT
TTGTATTACTCAGTACTAGCCACCCTGGTGCAGATCCTCAAAATCTCTCTCTGTAGTTAA
CTCTAATTTCCCTAAGGAAATATTGTATTAATTTAGGAAATACTACCTGCCATGTATGAA
ATGCTTAACATCTGATAGGAAGGTGCCAACCCGATTCCGGATAACGGAAATGGATTCGCG
TAAGTAGAACCAATAAAGTAGAATTCAGGATATAGATGTCCAGAAGTAGTACACTCGAAG
TCAGATTCAGGAAATAGTATTCTGGAAGTAGAACACAGGAAGCAGGATTCACAAAATAGA
ATTCAGGAAGGAAAACCAAGGAATTAAGATTCACTAAATAGAACACAGGAAGTAGAATTT
GGGAAATAGAACTCGGGAAGTAAAACGCAGGAAGTAAGATTCAGGAAGTGAAATTCCGGA
AGTAGAACACAGGAAGTAGGAATCAGGAAATAGGCCTCATGAAGGAGAACACAGGACGTA
GGATTCAGGAAATAGTTCTCAGGAAGTAGCACACGAATGAGGATTCAGGAAATAGAATAC
TGGAAGAAGAACACAGGAAGTAGGATTCAGGATATAGAACACAGGAAGGAGAATACAAGA
AGTAATATTCAGGAAATAGACCTCATGATGTAGAACACAGTAAAGCAGATTTAGGAAATA
GAATCTAGGGGGTAGAACACAGCAAGCAGTATTCAGGAAATAGGCCTCATGATGGAGGTA
GGTTTCAGGAAATAGAATTCCGGAAGTAGAACACAGGAAGTAGGATTCACGAAATAGGCC
TCATTATAGAGGATACAGGAAGTAGGGTCGATGATATCGAACTGCAGGAAGTACTACACA
GGGAGTCGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved