Cavia_porcellus Locus Mono:SNORD105
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:SNORD105
Cavia_porcellus
Mono:SNORD105
scaffold_368
SNORD105
1001..1085
2085
GCTCACTATTTTACCCTGCTGTTCCCGCAGTCCCGGCACCAGAAGCGCGCACGCGCCCA
AGCGCAGCTCCGCAACCTCGAGGCCTACGCCGCGCAGCCGCACTCGTTCGTGTTCGCGCG
GGGCCGCGCTGGGCGCAGCGTCCGGCAGCTCAGCCTGGATGTGCGGCGGGTTATGGAGCC
GCTCACCGCCACCCGCTTGCAGGTCGGCACTACCCGCCCTCGTACTGGCATCATGGCCGC
AGAAAGGGACATTTGTGGGGGTTTTGTCTCTGTCCGGGATTTGGGGTGTTGCAGCCAAGG
CAACCAGCTTGGGACTTAGTGTTTGCTTGAGCTAATGGTAAAGAATGGCGGTAGAGCCGG
GCGTCTTAATCTCAGCCCTCAGGGGGCCAGGGGCGGGAGGATCGCCGCGAGTTCCAGGTC
AGCATGTGCCACGTAGTGAGTTCAAGGCCAGCTTAAACTGCTTGGCCAAGACCCTGTCGC
CGAAAACCTCAAGGAAATACAGGGGTTGGAACTACAGCGGAAGAGCGCTCGCCCTGCATG
TGAGGCCAAGGGTTCCGTCCCAGCACCACGGAGAACCTAAGGACACCTTGGGGAGCGTGA
ATCGGCTTCACCCAGCAGAGATGTGGGGATGTCAATCTTTTATTTATTTATTTATTTATT
TTGTGTTTTTTTTGAGATGGGGTCTTGCTGTGCAGCTCAGGCTCGCCTTGAGCTCACTTT
GTAGCCCAGGCTGTTCTCTAACTCGCAAGGATCCTCCTGCCTCAGCTTCCCAAGTGCTGG
GATTACAGGCGTGACCCACCATGCCCGGCTCGAGATTTCATTCTTATTCCTGTTGGTATC
CTTTTTTTAATTTCCAGGTTCGAAAGAAGAACTCTCTGAAGGACTGTGTGGCTGTGGCGG
GCCCCCTGGGGGTCACGCACTTCCTTATCCTGAGCAGAACTGACCGAAACATCTACCTGG
TGAGCGGCTCCGCCCCCGCCCACCCCTGCCCACCCTATCCTGCCCCATCTCTCAGGATGA
ACCCCACGCCTCTGAGCCTCCATGATTCTGGCTTCAAAGTAAACGCTCTGAAGAGACGGG
CAGAGGTCCCTGCTCACCCTGCCTGCTAGGCACCTCGGCCCTCACCCTCCTTTCCTCCTG
CAGAAGCTCATGCGCCTCCCCGGGGGCCCCACCTTGACCTTCCAGATCAGAAAGGTAAGG
GAGGCAGAGAGGCTGGGCTGGGAGCTGGGCTGGGGTGGCCCCAGCCCCAACGGCAGCCAC
AATATGCCACTGCCGCCCTCCTTGCAGTACTCGCTGGTGTGCGACGTAGTCTCCACACTG
AAGCGGCACCGCATGCATGAGCAGCAGTTCACACACCCGCCCCTGCTGGTGCTCAACAGC
TTCGGCCCCCACGGCATGCATGTGAAGCTGATGGCCACCATGTTCCAAAACCTGTTCCCC
TCCATCAACGTGCACAAGGTGGGCCAGGCCTCAAGTGCGGGGTGGTGGTGGGGGCTGTTT
TGCATAGGGAAACTGAGGCATGGGCGATGAAGTGTTCATCTGTGATCATGGGGGCAAGAG
CAGAGGGGGAGGGTTTTTGTGTTTTGGAGGCAGGGTGTCTCCAGGTCCGCCAGGCTGCAG
CTGACTTGACCTGCTCCTCCTGCCCTGGCACCCCCAGCTGGGATGACAAGTGTGCACCCC
CGCCCCTGGTGTTAAGAGTTTGGTCTGTCCTGGATGCGCACGGGAAACAGCGCCTGGCAC
CTGAGTTTGTGTCTAGCTCCCTGGGCCCCGCGGTGCTGAGATTAGGGTTTATTGTAAGAT
GCTGCCACACTGAGTGTGTGGTGCACACCTGATCCCAGCAGCCTGGTAGGCTGAGGCAGG
TGGGTCACAAATCCAAGACCAGCCTGGGGAATTTGGTGACCTAACAAGGCTCTGTCTCAA
AAAAAAGGGGCTGGATGTGGTGGTGGCGGCTCACGCCTGTAATCCCAGCACTCGGGAGGC
TGAGGCAGGAGGATCAAGTTCAAGGCCAGCCTGGGCTACAAAATGAGCTCAAAGCCAGCC
TGGACTGCATAGTGAGACCCCATCTCAAAAAGACAAAAAAAAAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved