Cavia_porcellus Locus Mono:227:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:227:SNORA2
Cavia_porcellus
Mono:227:SNORA2
scaffold_154918
SNORA2
1001..1139
2139
TAGTCTTATGAGATCCTTGGAATGTCGTGTGTAGTCACTTAATCTTAACTGTTCCCTAG
CTACCAGCAGGAGAAAGGGATATATTCTGATGGTAGTGGTATTGGTGAATTTTCTTCTGC
AGAGAGAAGACCTTTATATCAGCCTGCAAAAATAGGAAAACTTTTTTATAAGGAGAGGTG
GGGCAATTTTGGCATGCTCAGCAGCTTGAGAATAATCTAGAAAGTCACTATTTTTCAGGT
ATGTCAGCTCAAATCACCCCGTTATATGTAAAAGTCCCACTTTCATCCATTCAGGGCCCT
AACCTTGACATATTATTACTGAACCAGGCAATGTGGGTTAAAGTATTTTGAATTAATTTA
ATAGTTTTAATTTGTATGAATGTTCATTTATCTGTTAGTCAATTTGAATAAATTTCCTTT
AGTGATTTTGTCATGTAGACACAACATATAACATATATATACAAAAATAACACACATAAA
CATATATATATATATACACACACACACACAAAGATTCTTTAGCATTTGCTTTAGAATCTT
ACTCATGAGACAAAGGAATATGCAATGTAAATTTATAGTTTATACAAGACAATTGAATCT
AAATTACATTTATGATGAAATGGAAAAAATTAAGGTCACTTGATTATGTGGTTAAACTTT
AAGATTTTTATTTGTAGTCTCATAAAAATATGAACTAAATTGTTCCAGGATAGCAGTTCT
CATAGTACCTTGGTTTTTTTAAAAGCTTCTTTTACTTTATGTTTTATTTTTCTCAGACTC
AAATGAGTTTAAGAGCTAGCTCTTGGATGTTTGTGTTCTAGCTCAAACTGGATTAAACAA
CAAACTTCCAGTGACCTTGAATGACAAATTTATCTTAATATAGTACAAGCAAATAAAGTC
AGCAGAAGAAAAATAGAGAACTTGCACATATTAACCCCATAGTGGTTGCTCAAGTATTAC
TGAAATGCTGTTCATTAAAAATCTTTTAAGTTAGGCATGTCCTGGCCCTGAATCAAGGCT
GGCAGCTTCTTGATGCTGTTGGTTTCAAGCAGGGGCCTAAAGAGATGTCTTTCTGTGGTC
TGTTGGCCATTTTAGAACTTGAGCAGTGAAATGGTCAATTCATTAGAAACAGCAGGAAAT
CAAGCAACCCCCCCCCCTCCTCCAGGAGTGGCTGTGAGGGTGGCAGGCTTCAGTGGTCCA
GGACGGGAGCCATCGGCACTTACTGGAACCCATGCCATGTGCTGGGAGTGCTGGGAAACC
AAGCAACCCCTCCCCCACCTGTTTTGTTTTGTTGAACTTCAATATGCATGAAAGTAAGGA
CAGCAATTTTGAAGAGAACAAGAGACTCTACCACAGCCATTAATGACTTCCTTATTGTCT
GGTTCTGAAGACCTAAAATGCCTTCCTCATTCTGTTCAGATCAGTTTTATACTATGTCGT
TTTGTATGAAATCTTTTTATGTGAAGACATGGACAACTATTTGGAAGAAAACAAGAGACA
GTACGATAGATAGTGAAGATCTCAGGTCATTCAACTTTGAAATTTATATCTCTTACATTG
CTTTCTTATGTCCTATTTTATTCTGTTTTGTTGTGTTTAATTTTACCCCCTTTAAATTAA
AAAGCTAGGTATGTCAAAGAATATTGATGTAAGCAGGCAGAAGCAAAAGTGAAATCACCA
TAAAAAGACCATAAGATGTTACTATACCTCGATTATGTTAAAAAGTCAAGGAATAGAGTA
AATGTGTGCCAAACTTATTCCTAGGGATTCTAGAGGCAAATTTCCCTGATGAGTTTGAAT
TAAACTCTACCAAATGGTGTCTCTAGGACCCATTTTCAGGCCACTTCTTCCTGAGCCCAA
ACAGTACTAGGATTATTACCAAAAAAAAAAAAGCACCTTTTACCTTTTCACAGATTGTTG
ATTAAAGTCACTTAATGTTGGAAAACGCAACTTAATAGGCTGTATGTGAGGATTAAATTA
ACATTTCCTATTCTTCAATATTTAGATATACCCAGGAAAAATACATAATTACATCATTTA
TGCTACAGTTAGAATCAGCTGTCATACCAAAGCAGGCTAGACTAATGTTTCCTTTCGGAA
ATGAAAGGAAAACTTCTGTGACTACCGATTCTGTTGTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved