Cavia_porcellus Locus Mono:400:SNORA42
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:400:SNORA42
Cavia_porcellus
Mono:400:SNORA42
scaffold_184694
SNORA42
1001..1134
1329
ACACCTTACTGTATAGAACACGGCGATTGCCGAATCAGGGAACCGTTAGATACCTAACC
TTTCCTCGTCAGTTCCAGCACCTTCCTGTGACGCCTGCAACTATCTGACTCTGGGTGTCA
CAGTTAAACTGCTCCCCAATGACTGTCTTATTTGCCTCTTTTTATCAGAAATGTTTATTG
GTTCGCAATCTTACATGTATGGGTTTGGATTTATGGCAGGCCTGTCCCCGTAGGCCTCTC
ATAATCTCCCATGCCAGAGCAAGTTGTGACCCTGAACCATTGCCTGGCCTCTCTACGTGG
GCTGCTGTCACTGAAACAAGGTACACAGCAGAAACATTAAAAATAAATGTAAATATAGTC
TTGACCAGAAATGTTCACATGCTTCTTTCCTCTCTTATGCATAGTTCTCCACTTTCTCTC
CAGCCCCAGCCACAAGCTTTCACAGACTTTTTGCTGTGCTGAGGCTGGAAGTCGGCCTCA
CACAGACAGGCCAGTACGTGGGTGCAGGCCCCAGTCTCTATTTAACGACCTCCCAGAGGC
CACAGAGGAGGCTCCCTCAGCTCCTGCTCTGTGGTGCTTTCTCTGCTGCCAGCCCCATTT
ATGTGAGATGAGGGTCCTCCCTTCCTAAAGTGTCCCCCTGCCTCTGTGAAGTCCCATCCC
CTTGGCCACCTCTACAGTTCGGCTCCTCAGGAACCACCTGCTCCTCTCACATATCTGCCG
ACTCTCCTGAAAGTGTCTGTTACTCATTTGAGATACTTCAGTTCATCTGTCCCTTCCTTT
TTTCCTCCTGTTCTTTCCTTTTCTGGGGTGGAGTTCATCTCCTTAGTACTGAGCTGTACC
CCCAGTCCTATTTTATTTTTCAGATAAAATCTTGCTACCTTGGCCAGGCTGACCTCAAAC
TTGAGATCCACTGCCTCAGCTTTAGAGTGACTGAGATTATAGATGTACACCACACCACCT
ACATCTTCCCGATTTGTTGAAGCCCCCACACTGGCCTTCCATCACAATACAGTGTCCTGT
AACCTCTGGCTCACTCTTTCCCTTTCACATTCATTCCAGCATTGTCATAATGGCTTCTTT
TTCCACCTCTGAGACGACTTCTGCCCATTGCACCATTGGCTTTCAGCTATTAAATCCAGT
TTTTTGTTCGTCTTTGACCTTTTTTGAACAGTGGATGCTCTATTTTGAGCAGTGACACAT
TCCTCTCCTACCCATAAAAATGAAACAAAAACCCCTCCCTTTCCCTGATTTTCATACTTT
CTTATGTATCTAATCCTCAGGCTCTTTCTGAGTTTACTCATGGGTTGCTCTTTTATCTCC
TCCAGCCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved