Cavia_porcellus Locus Mono:151:SNORA12
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:151:SNORA12
Cavia_porcellus
Mono:151:SNORA12
scaffold_207838
SNORA12
1001..1143
2143
GGGGAAGGTGACGAGGGCCCCGCCCTCCACAAACAGCCCGCAGCAAGGGACGCCGAGCG
CCGCCCCTCGCAGTCGCTGGAGCCTCGGGTCGGGAGTGACCCACTCCAAGAGCCAGGAGC
GAAGAAAAGGAACACAATGGCGCCGGTACCACCATCTTGGATTTTGGGCCCCCCTTTCTT
CCCTGCCTCCCCCCAAACAGCTCTTTGCTCTAGAAAAGAATGAAAGCAATGAAAATAACT
ACCCAAGTAAGCCCCAGCGACCAGACCATCGCCCGAGCAAGAAATATCAGGAACCCGCGT
GGCAGGATGAACAAGGAGAACCGCAGATGGAGGCGGATGGTAGTGAAGGCCAAAGCTTAC
CTGAGCAGGGCAAGCGCGTATGGCGGCAGAAACAGCGACGAAGGAGGGAATCAACCTTCA
CTTCCGGTTCCAGGCTTCCCTCTACCGCGGCCGCCCGCCTTTACGCCTGCCAGAGCGCAG
GCGCAAGGTGCCGGAAGAGGACCTTCGGAATACTGTAGTTCCGCGCGCCCGGGCTACCTT
TGGAAAATGCCTGTCCGAAAAAAAATTGTAAAGCCACTCTTAACTCCTCTGCTACCTCCA
ATAACAAAAGACATAACGACGACAAACGTGTTCCCTTGCCCCACTCTTTTCCACGCCCTT
CATTTTTTGTTTGGGTTTTTTCCTCATGTGTTCTCACTGGGAACCCCTCTATGGGCGAGC
CACAAACAGCGCGACGGGGGAACCAGCGGTTCCCACGGGGTCCTTGTCGCGGTGGTCAAG
GTGACCGGAGGATCGCTGGGCATGCGCAGGGAGAACCGTCTGGCCCCAGTTGAGGACCGA
GTAAACGTTATGTCAGGAACGCGTTTGTCAGGAGTGAGGCGCGCTTCATGGTCCAGGGGC
AAAGCTCAAAGTTAAACGGGCTGATGCAGCTCGTGCCCTTAGGAGGAGACCAAGGTCTGT
GCATCAGGAACAAAAATCGGCCTGCAGAGTTAAAACTAAATAGTTGTGGTAGTTTCTTTC
TGGCACATTTGTTAAGTTTTCAAATGGGTCTGACTCTACCACATACATTGTAAGGAGCTA
GCAAAGCTTTAAAGACTGAAATGCCTCTCGAGCTTTTTTGTATGAGACATTGGCTCTCAC
AATCGATCTCATAAGTTTAAGTCCTACAGACAGGCTGACAAACAACTGCCTGGTCTGAGG
AGAGTCTGTACTGAGGGCCGCTTTTCTACCCCTGTGATGGATTTGCTAAAAAAAAATAAA
AAATAAATAAAACTAAATAAGCCAGGCGTGGTGGCGCACTGCTACAATCCAAGCACACCA
GAGGATGAGGCTAGGCGAGCTCAAGGCTGCCTAGGCTACATAGTGAGTTCAAGGCCAGCC
TCAACTACACAGCGAGCTTCTGTCTCAAAAAAAGCAAGCAAACAAAAATGGTAAGGCTTG
AGGACTGTACTGCTTTCCATGAAATTGTCAGTTGGAACCGCATGTTCTTTAGTCCCGCCA
CAACAGTTCTGGATTTTTTCATAAATGAAACATCTGACATCCCCCTTTGTACACGCTGCA
GAAGTCAGATGTGCTGCTTAAAACTGACAGGTGTTTGGCCCTTTTCCTTTTAGGGTAATC
ATTTAACCACTGTATCCATTTTTTAGACAAGCAAATAGATTTGGAGAAGTAAAACAATGT
ATCCAAAGCAATATAACAGTGTGACAGCCAGGGTGTAAACACCTTTAATTCTCTATTACC
TCCCTGCTTACCACTAGCACACACACTATGGATTACCTCCCTTGGTTCAAGCTCTTGGGT
CGTGAAGAAAAATAACTGCTCCAAAGAGGGAGTCACAAAAGACCAGTTTCCCCAGCCCTG
CATGTTAAGTTTATTCACAGCACCTATTCACCTGCCCACTTGTGCTAAGTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved