Cavia_porcellus Locus Mono:653:SNORD93
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:653:SNORD93
Cavia_porcellus
Mono:653:SNORD93
GeneScaffold_7321
SNORD93
1001..1073
2073
TTCTCAGGAGTTTCTAAGTCTTGGGGTGCTTGTGCCCGCATTTTGAGCACAAATGACCA
TTCTGAGTGTGGTTACTGATACAGATTACTGTTCTCTAAATTTAGTAAAGTGTGTAAAGA
TCTAGTGAAAGGCGCAAGAGATCATGAAAGCCGTCATAGGTGCTCTTAGTTCTCTGTTTT
CCTCAATTGTGACTGATTACCTTTTTAATGATCAAAAGGTTGAACGGAAATCAATGGTAG
TGTGCCTTTAAAGAGAAAGTGTAATGCCCGGCCTTGAGTTACGGGAATCTTGTTCAGCCC
TACTTGTGGGGCCAGATCACATGAACAACTTTCATTGTCCTGAGTATCTCAGTTCTGGCA
AACTGAACAGGGAATGGTTTTACCATTGCGGTAAGTGTTAGAGTTCCTCTGGAGCCAAAG
CATGTAACTTCAGTTTGACCCGTGAGATAAACAGAGAGCTTGGCACAACAGGGCTGCAGC
CAGGGTCTATTTATGGCTGTGGAACCGGGAAACTTCTTAGTCTCAGCCCCAGGGTAAACA
AGTTAATGCTTTTTGATTCTTAAAATCTGGGAAGGGTGTGCTTCAGGTTTTTTACCCTAG
GAAGTTACCATAAACTTGATGTTATTTCATGCTAATTAACAAATATAGTTGGAAAGATAG
TAACCGCCGGGCGGGGGGGATTCCTTGAGATTAAGGAATTTTGCTTCATTTCGCTCACAA
CTGGAAATTACAGAAGACCCCCCCCCCAAGTGTCAAGAAATTTGAAGGTCATGGCTTTAT
AAAAGAGTTATATTTAGAGATAGTGTTCTGTGTTTTTCCTCAAAGGTAGCCAAAACAATG
GCACTCTTCCAAAGACAAAAGTTGTAGCCTGGTATTAATATTGCTGTCACTTTTTTTGTT
TGTTTTCTGAACCAGGCTCAGTGGAGTGCAAGATGCTGATAAACACAAGGTATGAACCTA
TTGAAAAATGTTGGGCTTGCCTTGATAGTGCATAGAATTCCTGGCCAAAGATGAGAACTC
TAACCTGAATGGCTGTGTTCTGCTCTGATGGGTTAAAGGATTTACCTGAGGCCAGCTTGA
TAGGACTTTATTAAATTCATCCACTGCCCCTTTTGCTTTAGGTAAAAGGGGGAAAACCCT
GTCTTGTAGTAAATGGACCAATACCAAATTAAGCCAAGAGAAAGGATTTTGAGTATTAAA
AAATATGTTAACTGAGTCACAGCACTTAATATGTACCTACCGTGATATTTTCTTTTACAG
GTCTGATGCTTGAAAGAACTGATGACGCTCTTTAAGTAGATCAGGTACTTTTGACTATGT
ATGCAGAACAGAGAATTTGCGCCCCACTTCCCTTGTATTGTAGCAGGGGTGAATTTTGAA
ACAGGCCCAATTACATGTAGGAATATGTATCTCAGAATTTTCTGCCTCTGCCTAGAACTG
TTGCCCCAGCAGAGACTAAATTTTTGTACAATTTGTTTGTTTTTAACTAGCCCTAGTCTA
AAACTATTTTGAGAATCATATACTGTGTAAAGGTGGCTGAAACTAATTCATTAAGGTCAG
GACTAGCTATTTTAAACTATGTAAAGTGTTTTGCTTTTGAAAAAACATGGTCTTTGTATT
TTTTGTGCAGTAGATTATTTTAGTGATTAGATTTTGTTCTTTTGGCAACATGAATTGCTT
CCAAGAAATCAGAAAAGAGTTGACTGCAAAGAGGCAAGAGGGACTTTCTATTTTTTATTG
TTCCACAATTGTTCTACTTCATTATAGTGGTTGTTACATAATTATACATTTGTCAAATTT
ACACTTGGTGGGTTTTGTGGAATGTAAATTGATACTTCAATAAACATGGCTTTCAAAACT
TTTCTGGTGTCTTAATAACTTACTTTTTTTTCTTTTTGAGACAAAGTCTCACTATGTAGC
ACAGGCTGCCATGAACTCCCATGATCAGCCTCCTAAGTGCTGGAAACAACATCATGCTCT
GGCGGTTATTACATTCAAAGTTTACCTTTATGGATAGTTGAGGTATCAGCACACATTTGC
TCTAACTACTCAACTGCTTGGCTATGATGTGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
NT_176375
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved