Cavia_porcellus Locus Poly:5:SNORA63
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:5:SNORA63
Cavia_porcellus
Poly:5:SNORA63
scaffold_256827
SNORA63, SNORA63
1001..1132, 1630..1760
2760
AAAATTTTCCATAATTTTTTCATTAACTGCATAAGGTAACGTGAAATATAAAAATGACA
ATTTTATTAAATGTATTTAATACAAGGATCCATGGGTTCAGGTGACCCCTGGATAGCACT
GCCAGAGCAAACCCTTAGATGGTTCAGTGGTTGAGACGAATGTTATTGATTGAAAACTGG
TGGTCAACTTAATGCCAGTGGAATTAAATTACGATGCTGCTGAGCATAAGTGTTTCACCT
GAGGAAAGTTGCCAGCATAAATAGAGATGTGGAGAAGGAGAAGGGAGGTGCGTTGGGGCC
TTGAGGCTTTATGAGAACTCATACAAGTTGCTTGGGGCTAGGTAATGTTTTTCTCATGGA
TACACATAAAATAGTGTGGTGCCTTTCAGGACAGCCTTGGTCTTTGTTGTGTGACTTCTC
TGCTTCAGCGTAGAACCCTCGTCCCACTAGCACAGCTCTTTCACCCTGCTGGCATAGGCT
TCCTAGTTTCCACCACTGACCTTTGGGCCTTCCCGGCACAGATCCGTAAAAAAGACTGGC
ATGAGTCCTTCTTGTGGGTTCTGGACCTTCAGTTGGTCTTGTGGGAGGCATTGTCATGAG
CTTTGGGTCTTCATCTGGAATCATGTGGGACATTGCTGTGGGATTTAGGCCCTTGGCTAA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACAATGAAAGCTGTTTA
ATGTAGGAGGGTTCTTCTTTTATAGTTTTTTTTCCCTAATCTAAACCTCAGTAATGAGGT
TTAACTTCAGTATTGGCACTTTGAAGTACATAAGTGGATTTGGGCCTGCAGCTGAGCCCT
TGTCTCTTAAGAGATCACTGAGCTGGGGATTCAGGGTCAAATCTATGAGGTTGACTAGGC
ATTCAATCCAGGGTTCAGTGTGCATAGCCCCTTTCTCTGGCCGGCAGGTTGGGATGTCAC
AGTGTAGCTGGGAAGTGCTATATTGTTCTGTCCCCCTGCCAAGAGGAAGTGTTTCCCACA
ATCTCTGTCTAACTCAGTTCAATAGTAAGACAGGGACGCTTGGTCTCAAACATTTCTCTA
GTTGTATTATGAAAACTGTCGTATCTGCTTAGTTGATTGTTCAGCATTATTTATTCTTGT
CTCTTCTTTAAGACTGTGTTGCTTTCTGCCTCAGAATTAATATACCAATGTGATCGAGAA
GATAGTGAGAGATCCACTTCAAATTCTGGTGAAGAAGGAAGAGGTAACCCCTGGAAAGGA
CCTGTGTTTTACAGTAATTTTGAAAGAAGGTAATGTTTTTTTCATGGATACACATAAAAA
CAACTGCCAAGGCTTTTTGATTTTGTCTTTTTTATTGAAACTCTGCTGAAAATGAAGAAA
CCAGGATCGTGTCTTAGTATTCGTAATGTGGCTAGCAGAGTAAGCACAAGATGGAAAACA
AGGGCGGATGTGGTAGTGCATGCCTGTAATCCCAGCATTGGGGAGGCCGAGGCAGGAGAG
TTGCTGCAAGTTTAAAGCCAGCCTGGGCTACATAGTGCTGTTGATATCTACTTATTTTCT
TAGTAAGCAGAGGCAGGATCTAGGTACAGTGTAGCGTTGAAGTGCTGCATTGTGTGTGTT
TCCTGCTCTAAATAAAACTGTCACCTTCCTGGCCCTGCCTGCCATGGTATCTTAGCAGCA
GGGATGCTTGGTCTCATACATAGTTACCATTCAAGCCTGCGATTGACAAGGGACTCTTGG
GAATAAGGCCTGTTAATATTTTGCAGGTGGTAACAGAAGGAAAAAGATGTTATCTGGAGG
GGATCCAGGTAATAAACAAATGATACTTTTGTCACTGACTAATTGGTAAGTATTCCAGTT
CCATGTTTAATTACATTATTAGTCTGCCAAAAGTGGGTAGAGAGAAAGAGTAACAGTCCT
CTACCCACTCTAGCTGAGGGAAACAAAGGCCACAGTGGCATGCACAAAAGTGTGCGGAAA
TTTCTCTTCAGATCAGAATTTGGATATATACTCTCTTACCAGATTCTCGATTTTTACATA
CTGCTAATGGCTGTGGTTTTACACTGACCTGCCAAAGTATATTCTTAAGTATGTGTTACC
TGCTTTGAATCCCTTGCTTTTTTTTTTTTTTTTTTTGGTCTTTTTCGTTTTTATCGGTAC
CGGGGATTGAACTCACAACTGCCTGCTTGCAAGGCAGGCGCTTATGCCGCTGAGCTAAAT
CCCCAGCCCCAAATTCCTTGCTTTTGTTTGGGTGAAATAAATTCGTGTATTGGTTTTCAA
GGTGGTTTTTGTTAACCGGAGAACTTTTAAAGTCAGGCAGATGGACTGGGGATTTAGCTC
AGCAGCACAAGTGCTTGCCTGGCAAGCACAAGGTTGTGAGTTCAATCCCCCATACCAGTA
AGTTAATAAAAAGAATAAATATCAGGTCAGGCAGATGAATTAGGAAAATGATCCTAGCAC
CTTGTAATATAACTTGTTTAAATTGTATTGGGGGAGATTTGTGGTTGATCAGTAGGCTAT
GAAAAAGCACATGTGATAGGTAACCCAGATTTTGGACACAATAGTGTTTATATTAAAAGG
TAAAAAATCAACAACAATGTTATATCTAGTTCTCCTTAGCCTACACATTTTTTGTGTGTC
GTGTTGCTCATTTCTTGTGCTTTCTTGACAGTTTATAATGGGAGCTTTCTCAGCATTTTC
T
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved