Cavia_porcellus Locus Mono:517:SNORA38
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:517:SNORA38
Cavia_porcellus
Mono:517:SNORA38
scaffold_283988
SNORA38
1001..1111
2111
CTGGCGAGGGTGCAGGAGAAAAAGGAACACTGCTCCACTGTTAGTGTGAGTGTCGACTG
GTGTAACCACTATGGAAATCAGTATGGAGAATTCTCAGAAGACTAGGATTGGAAGTTCCA
TTCAACTCAGCTAGTCCCCTCCTGGGTATTTTCCCAGAAAAACTGAAAAGTTCATGTCAC
AGTGATGTATGTGCACCCATGTTCATGGCAGCACAATTTGTAGTAGCTAAATCTTGGAAA
CAACCAAGATGCCTATCAACCACAGAGTGGATGGAAAAGATGTGATATTTTTACACAATG
GAATATTACTCAGCTGTAAAAAGGATGATCTTGAGGCCTTCATAGGCAAAGGGAGACAAC
TTGAGACAATCCTCATTACTGAAATAAATAAGAGTCATATTTATAAATATCGCATTGTGT
CTCTAGTGTAAAAAGTAATAAGAAATTTAAGAGTAACAAAACACAAGATGTGTAAATGCT
ATTCTAAAAAAGAGAGGAAAAGGAAGTGCTCTAAAGAATATAACTGCATGTATGCTTGAA
TGTATAGGATTGATAAACATTACCAAGTTTTTATTGGATAGTTTAACAGAACTGTTTGCA
GTCACACTTTTTAAATGTCCACTTTGTATGCTTTACTTTTGTAACTTGAACAACTATTTC
TAAGAGGACAATATGAAATTATCAACTAGTGATTTCTTACTGTTTTTTTGAAATTATGTA
TTATTTCTACTGTTTTTGTGTTTTGTTTTTTCCTTTAAATAAAAAAAGAAAAAAGTCAAA
AAAATAAGCTGCAGATACAAAGAGCATTGTTCAGAAAAAGAAAGGGTCAGGCAGCGGATT
AGTTTTTATGAACACATTCATTTACTTAATAAAATTCCACTTGCTATTTCATATATAAAG
TTAGTTACTATTTAAGAAAGAAAAATACCCCACAGGGAAATTCGAAAATTTGAGATGAAT
TTAACAAATAAGGCAAAAAAAATTTAAAAGAAAGTTGCTGTCAAAAGAAAAAAGAGAAAA
TGTGGATATTCCCTTTATTAAAATAAAATATACTTGGACACATCTGGGGCCAGCTTGCTC
CCCACAGGCTCAAGATCAACCATCTCACATAAAAGCAAAGAATGTTAGATATATATTGCA
TTATATATACTATATACAATATATAATATATAATATATAATATATAATATATAATATAAT
TGTATTATAATATAATTTGATACTATATATACACACACATATGCGTATATATATATATAT
ATATATATATATATATATATAATCTCAGCCTTGGCAATAAGGATTTCTAGGACTGTTCCT
GAAGGGAAGGGTGACTTCTAAAACATTTGGAGTAAGTGGGTGTTAGGACATCGAGGATGT
CTAAGGCGGCATGGGTCGGGAGGTTGTCAGAGCTCCTGAGTGAGGCAACTGTTGATCCTT
CTCTATTTTTCTTCAGCTGCCCCTCATCATGGCCTGCAGAGTCTCAGGAAAGGCTCCATT
GCCACCCCAGCACAAACAAATAGATAAATAAATACGTCATCTGTCATGTATTAATTATTA
GAATAGTTGATATTAGTGCTGAATCAAAAAATCTCATTGTCATAGTACTACAAGTTTTTT
TTGGCTAACGATGACATTCTAAAGTAAAGAATATAAAATACATTACACTTTCACTGTAAA
GAGAAAACCAAACACATTACATTTTCATTGTAAAAATGAGTTTAAAACACACAACAGTAA
AAACTAGAAGTCTCACTCTTGAGGAGGCTATGATTTAATAAATCTTCAAATATTGGAACA
GCTTGTGGAGCATGGTGATCAATACTTTACTTATATTGAAAGCAAAACAAGGGAAACTAG
ACTTAGTGTTAAGCATGACAGATTTGAGTTAGCAAATATTAAGGTATTTTCCGACAGGGA
GAGCGATGCTGCGAAAGTTCTTTTTTTAGGTCTTTAAACAAGAAAGGCTTCTTACATTTC
TGTGATTCTTTGTGCATTGTCTGACCAAGGACTGAAAAAAATAAGTAAAACGATCTCTTT
TCACACATATGATCTCATTGTGTTGAATGAGTATAATTCTGTTACACTCTTCCCTAAAAG
TTAGAATTAACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved