Cavia_porcellus Locus Poly:28:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:28:SNORA2
Cavia_porcellus
Poly:28:SNORA2
GeneScaffold_526
U8, SNORA2
1001..1132, 3221..3357
4357
CAGTGTTTTGGTTTTATTGGTTTTGTTCTTTACTGTTTTGTGCAATTTTATTATAACTG
ATGATATAGGCAATTCTTTTTAAGATAGCAGGAGGCATTTTGGTAACCATTGTTGATCAC
CTTGTATTTTGTTTTTACATTATGTATTATGTCCATCCTTTTGATTTGACTGACTCTCTT
TTGTTATGTCACATTTGGTTTTACTCTCTTCAAAAAAAGTAATAAGAACGGTGGGAGTAA
TAAATCCCAAAATATGTTATTGTCATTGTACAAAAGAGAGGAAAAGAAAGTTCTCTAAAG
GATATAACTGCGTGTATATTTAAGTGTATAAGATAGATAACCATATTACTGAGTTTTGTT
GGATCATTGAACAGAACTGTTTGCAGTCTCACTGTTTGAATGTCTACTTTATATGCTTTA
ATTTTGTAACTTGAACAACTATTTCTAAGATGACTATATGTAATCTATTAACTAGTGATT
TCCTACTGTTTATTTTTTCTGAAATTCTTTATAACTTGTACCCTTTTTCTGTTTTTTTTC
TATTTCTCCTTAAATAAAATTTTTTTTAAAAGAAAATTTTTTTTGTAGTTTCTTTGTTTG
TTTTATACTTTAAAATAAAAATGGATTTGGAAAAAAAATACCCTCCTGAACAACCAGTGG
GTCACAGATGACATTAAAGAAGAAATTAGAAAGTTTCTACAATTAAATCATAATGACAAC
ATAACATACCGGAATTTATGGGACACAATAAAAGCAGTCCTAACTGTGAAATTTGTATCA
GTGAATACCCATATCAAGAAAACAGAGCAAGCACAAATAAACAACTTAATGTTGACCTTC
AAACTTCTAGGAGAAAAAGAGCAGGTCAAGCTCAAAGTTCATATGAGGGAGGAAAGTATA
AAGATCAGAGCACAAATTAATGCATTGGAGACTAAAAAAAATTTCAAAGAATCAATGCAT
CAAAGAGTTTATTCTATGAAAGATTAAATAAAATCAATATATCATCAGGTGGGTTAATCT
TTACGTTCCTCCTTTTGGAAGGCAGATAGAATATGATTGGAGTACTGCATGACATGTGAT
TAATATATTGTGTAATCAGGACTTGCAACACCCTGATTACTCCTAATTCTAATAAATAAA
TAATAAAATAAAATCAGCAAGCCCTTAACCAACCTTATCAAAAAATAAAAATAAAAAATA
AAAGGGAAAGAGTCAAATCCATGTAACTATGAATGAAGAGTGCAATCACAGCAGATCCTG
CAGAAATCCAGAAGATCACGTATACTAACTTTTTTTTTTGTCTTTTCAAGACAGGGTCTC
CTATGCAGCTCAGGCTGGCTTTGAGCTCACTCTGTAGCCTAGGCTGGTGTCAAATTTGCA
ATGATCCTTTTGCCTCAGCCTTCCTGAGTAACTGGAGATTACAGTAATGCACACCACCCC
TGGCTAATGCTTACCTACTTTTTTTCATACTTTCTGTCCTCATGTTATAGATGAGTATCT
GTTAATAGCATAGTTTACATTAAAATTTTTGGTCTGAAAATCTTTTAACTGGAACATTTA
TTTGCCATAATTACAGATACTTTTTTTTTTGCCTCCCCCACATTTGGTTTTTAAGTGTTT
TCCATTTTTCTACCTGTTGTAGGTGCCCCCCACATTCTTTTGAATTCTTTTATTCATTTT
TTTACTCTGTTATATAGTTTTACCTTTTCTTTTGTTTTTTTTTCTCTTTCTTTCTTTCTT
TCTTTCTCTCTTTCTTTTTGTGGCACAGGAGTTGGCAAACTTCTTAGCTTTGTGGATTAG
TTTTGCTATTGTAATGCTCAAGCATCCATATTAACAGGCAAAGGACACTGGGCTGAGGCC
AAAACTCTGGGAAGTATTTTTAACTTTTAAAATGAGGTAATAGAAAAAAACAGTTAAGGA
GTAAGCAAAAAGAAACAGCATATCAGGAATGTTATAAGAAAAATACATGTCCTTTGAGGG
CAGTTTCAGGAATGGGTAGCTGACTACTCTAATGCTAATAGTGTGTTAAAGATCAGGAAG
GGTAGGCATGGTGCTGCATGCCTAGCATCCCAGCAGAGGAAAGGCAGAGTTCTGCACGAG
GATTGCGAGAGTTTGAGGCCAGCCTGGGCTACCCAATGAGTTCAGGGTCTCAGCCTGAAC
TGCAAGTGAGACCCTGTCTCACCATACCCCCTCAATCCCCACCTCTGCAAAAAAAGAAAA
AGATTAAGAGAACATGTGGGTTCGCTAATACTATTTTTGAGATTAGTAATCACAGAATTG
CCTAGATATATTGCCTAGGTTTTCTTGTCTCAGAGTTATTATTAGGTCTGGAAGTGTATA
TTTTTAAAAAATTCCCTGAATGATTCTGATCTTTTCTTATACTTCAGAAGTATAAATACA
GATTTTTCAAGCAGCTTAGCTGGGACTGACTTGATGTAAAGATGGATTTGTAAATTATGT
TTTTAGGGAAACCCTTTTTGTCAAACACAAAGCAAGACCTGATAAAACAACCAAAAAAAG
AAAGCCAAATTGATAGAAGTTGGGCCAAAAAAAGTTTTTATGTTTTAAAAAGGGACAAGA
ACTCTTTGGTGAATGAGGCTGTTGTCAGGAACCTGCGGCTAAAACAGCTGAGGTTTGGTT
TCTTAGAGATAATGGGAAAGTAATTGGAGTTGGGCTCTTTGTTGGAAGTTTTGGCTAAGT
TGACCTCTGGTGAAAAAGGAGGTTTTCAATTTAGTTCTAGAGCTGCCATATTAATACAAC
TTTAGGCAACAGATTGTAGTCATTTAGCATGACCCCTTAGGGTGATAGGGCCCAGTCACA
GGCACAGCCCCCTGGCTATAAGAAGCAGTTCATCTGCTGACTGCTGTCAGAGGCAGGCAG
TTTATATGAAGCGCTATGTGCTCAGCAGTTTGAAATGTCAACACAGCTTTACATTTAGGA
ACTTTCTAGCTTATTGGATATTGCCCTACTGTTCTTGTGGAGCAGAATCTACTATTTGAC
TAGAATAACTGTAAAATATATCTGAGATAATTGGGGAAAATTGAACAATGATTATATAAT
ATTAAATTTTATTAATTTTAATCTGGGCACAGTGGCACATACCTGTGATTCCAGTTACTT
GGGAAGCTGAGGTGGGAGGATTTTGAGGCTACATTTGAGGTTAGTCTGGGCAACATAAGA
GACCCTGTTTAAAAAAAATTTTTTTTAAGACCAGCCAGGGCCTGGCCCTGAATCAAGGCC
GGCAGCTTCCTGATGCTGTTGGTTTCAAGCAAGAGCCTAAAAAGATGTCTTTCTATGGTC
TATTGACCATTTCAGAACTTGGGCCGTGAAATGGTCAATGCATTAGAAAGAAACAGCTTG
AAGCAACCCCTCGCCCCCATGGTGAGCAGCTGTGAGTGTGTCAGGCTGCAGCAGCCCAGG
ACGCAAACCACTAGACCTACACCATGCTGGGACCTGGAGCACCAAGCAACCCCTCCCTCC
CGTAAGCGGCTGTGGTCATGGCAGGCTCTGGCGGTCCAGGGATGGGAGCCACCAGTGTTT
ACTGGGACCTGCACCAAGTTGGTACCTGGAGTGCTGGGAACCAAGCCATCCCTCCCTTCC
CTGGTGAGTGGCTTGTGAGCATGCAGGCCTAGGGGCACCCAGGAGGAGGCCACCAGCATT
TACTGGACTGGCACCATGCTGGGACTGGATCAGGAAAACAGGCACCCCTCCCTCCTTGGC
TTGTTTGTTTGTGGACTCCGTTACTGGAAGTTGGCACGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCGCCCCGGCAGGACCCTGTCTCA
AAAAGAAAAAGTTAATATTTAGAGCTATGATTATGGGAGTGTCATTATTTTAAACAGGTA
GTAAGCACATTCCCAGTAAATGTTTGTATGAGAAAATAGTTCCCTTAGGCATCCGCCTGC
AGAGCTAAATTCTCCAACACGTGCTGGCCTCTAACAAGGCTCAAGAATTTACAGAGTAGG
ACTGACAATTAGAAGAGTAATTTAGTATGGATGACATTAAAATGTTCACCTAAAAAATAT
TAAATTACATATTTAGAATTTTCTAAATAGGTAAGTAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved