Cavia_porcellus Locus Poly:4:SNORD113
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:4:SNORD113
Cavia_porcellus
Poly:4:SNORD113
scaffold_279590
SNORD113, SNORD113
1001..1073, 3230..3302
4302
TTAATTAATGAAGATGGACTGAGGAGAACTCTTGTCGTGCCTTGGGTGATGAGTTTAGA
GGAGCCTCTGTCCCTTTGAAAGTGTGCAGCATAATTACATAAGGCCACTTGTCATCAGTG
TGCAGTTGGCAGCAAGATAAATCTCTTCGCTAAGTGACGCATAATCAAAAGCCAAGGATA
ATAAATGCACAGGGATATTTGCTGTGAGCGCCATTCTGAACACAGGCGACAGAGAGCAGT
ATTCTTCCTGGGTGTCTGGGAATCACAGACTTTGAGAAGGATTGTCAGTGATTTAAGGAC
AGTTAATACACAGTGTGGAAATGGAGGAAGGGAACTGGACCTCTCCTGGACCAACAGTGA
CGTCTGATTCCCCACGTGTCTCACACTGAATGATCCGTGCTTGAATCTCTGAGTCTAGCA
CAGAGGGCAGGTGGAGGAGCCAGGGGAGGACATGTCTCATCTCCTCTTCCTCTCTGCTTG
TGCTCCTCAGAATGCATGCACCCCAGAGGGCAGGACAGTTGTTTTCTTTTTTTTTTTTTT
TTTTTCTCCTTTTCATCGGTACCGGGGATCGAACTCACGACTGCCTGCTTGCAAGGCAGG
CGCTTATGCCGCTGAGCTAAATCCCCAGCCCTGACAGTTGTGTTCTTCCAGGGTTGCTGA
CTGTGGTGACGTCTGTGCCTCAGACCGCAGGACAGAGCAGGGTGAGTGGTGGCGAAAGCT
CTTGATGTGTGGAAGCTCATTCACTGCCTTACTGTGGTGTGAAAGCTGGTCACGTTGGGC
AGGTGTAACTGTGACCAGTGTGGACGTGGTCACAAGGAGGGTGTGGGAGCTGCGGTCAGT
TACTGAGGGAGGTGCCCAGCGAGTAGAGGGCGATGCCCATAGGCAAGAGCACCGAGGCTG
TCTCAGGGACATCGCAGTGACAGGCTTGAGATTATCCTGAGCGCCCTGGCGACGGAGCCA
CCACATGGTGCGGCCAGGGAAAGTGCAGAGCGGACCAGCGCTGGATGCATGATGACCACC
TGTGGGGTATGAGTCTGATGCGATGAATACCTGTCCTGGAACTCTGAGATCCAGCCCCGG
AGGCCTGGTCCTGCTTGACGTTCCTGTGTCCCGTGTCCTTCTTACAAATGAATTCATAAA
ACCAGTGGCTCCGTAGACCCAGAAACCAGGAGTAGCCAAAGGGTGAAGCATTGTCCATTT
ATACATGTTGTTGGTGAGCAATTCTGTTAATATTTATTGCCAACACTGAGATATGAAATG
TGTGACCTGCAGCCCTTGGCTAAGAATCCTGCGTGCTGTGCAGAGAGGATAGGGGTGGGC
TGAGGCTTGAGGTCATGCGTCCATTTCCAAGGACATTGAGGCAGAAAGTTACGTAGGCAC
TTGGAATAATAGTGCCTGCATGAAAGGTAGCACGGCACAGGTCAGGGAGGAAAGCGTTTG
CATCCTCTGCTCTGCTCTGTGCTCCTCAGAATGGACACCCCCTGCAAACCCCCACATCCC
ACCCTGGTCTCCTGCATGTGGCCGCCTCTTGGGATTATCCTGTGGACCCTTCCTGTGAGT
AAAGGCAGTGTTCTCATCTGCATCTTTGCTTTTTAAAAAGTGTTTACTACAATATGAAAC
ACCACTGAGGAATTCCACATATCCTAGTGACAGTGCCAGATAAAGAAAGCACTGTGGTGA
TTGTTACATATAAAAGTCCTTTTGTAGCTGGTTGTTTGTGCATTATGCTTCTAAGTTGGG
AGTCACGTGATTTATTCTAGTAATTACTTAATTAGTGTACAAATGTCAATTGCAATATAG
GAGGACCAATCTTGGTACAGTGGTGACAGCCAGTGCCACATATCTGGAGCTCCAAAGACC
AACGTAACTGGAACCTTGTTCAGTTCCCCTTTGTTTTAAAGAATTCCAATGGACTATATC
AGGAGGAAGAGTGGTTTTGTCGTTGAGCTTTCATTAGATGAGTGAAAAACTATTATTGTT
AAGGAGTCAAGGCTAGGATAAATCAAAAACATACACATAAAAGGAGATGACAAGGAAAAA
TACTTGTTCTTCCTAAATAGCTGGTAAAGAAACTAAGTTAGAATATAAAAGGAGTAGACA
GTAAACTGATCCAGTGTATTTCCCCTTGACCTAAAGATAGTATAGAGAATGACAGGTGAC
ACCGTGTTTGGTCCATTGCAAATCTGAACTTTATCATGTTGCCTAGATAACCTGAATTTT
TCAAAGCCTAAAAGCCTTCAAGGGAAGCCATATGGTGGATGATAAGACCAGTGTAAGTCA
CAGGCAAAATTCCTGTCCTCATTCCATATTTCCTTATAGGAATAGGCAACAGTGTTGAAA
ATCAAATTCAATCATGGCTAACCTTTAACTAAGGACAAGTCTTCTGTTGGCTTGGGTGGT
GAGGTTAGGGGAGCTCCTTGTCTCTTTTCAAAGTGTACAATGTAATCACATAAAAGCAAC
ACTAATGGATATAAAGTTGGCATTAAGATAAATCTTTAAATAAATGTCACTTATGTGAAA
AGTTAAACATAATGCAAGATATATATTGCTGTGAGCGACATTCTGGATATATGAGACAGG
CCTCAGTGTTCTTACTGGGTGTCTGAGAATCACAGACTTTAAGAAGGACTGTCAGTGATT
TAAGGACAGTTAATAGACAATGTGGAAACAGACCTTTCCACATTGCGGCCTTTCCTGGAC
CACGGATGATGTCTGCTGGCTAATGAGTCTTTCACACTGAATAATCTGTGCCTGAAACCC
TGAGTTCGGCACAGAGGGCAGGTGGAGGAGCCAGGGGAGGACGTGTCTCATCTCTTCCTC
TCTGCTTGTGCTCCTCAGAATGCAAATACTCCAGCTGACAGGACAGTTGTGTTCTTCCAG
GGTTGCCATCCATGGTGACATCTGTGCCTCAGACCGCAGGACAGAGCAGGGTGAGTGGTG
GCGAGAGCTCTTGATGTGTGGAAGCTCATTCACTGCCTTACTGTGGTGTGAAAGCTGGTC
ACGTTGGGCAGGTATAACTGTGACCAGTGTGGACGTGGTCACAAGGAGGGTGTGGGAGCT
GCCGTTAGTTACTGAGGGAGGTGCCCAGCGAGGAGAGGGCGATGCCCATAGGCAGGAGCA
CCGAGGCTGTCTCAGGGACATCGCAGTGACAGGCTTGAGATTATCCTGAGCGCCTTGGCG
ACGGAGCCACCACATGGTGCGGCCAGGGAAAGTGCAGAGCGGACCAGCGCTGGATGCATG
ATGACCACCTGTGGGGTATGAGTCTGATGCGATGAATACCTGTCCTGGAACTCTGAGATC
CAGCCCCGGAGGCCTGGTCCTGCTTGACGTTCCTGTGTCCCGTGTCCTTCTTACAAATGA
ATTCATAAAACCAGTGGCTCCGTAGACCCAGAAACCCAGGATCATAGTATGTCTATAAAA
TTATGGAATGAAGCGAGAACTTAATTCAGTAAAAACTAAAACATGCCATGTGTGAGTGGC
AGCCCTTTGGCTAGGAATCGTGCATGCTGGGTACAGAGGGCAGTGATGGGCGGTGGGTTC
AAGGTCATGTGTCCGTTTTAGAGGACAATGAAACGAAAATACTCAAAGCAATGAGTTCCT
ACATGAATGCCTGCATGAAAGATAGCAAGGCTCAGGTCAGGGAGGAAAGCACCATTTGTC
CTCTGTCCTGTGCTCTGTACTCCTCAGATGGACGCTCCTAGAGGCCCACACGTCCCACCC
TGCTTGCCAGCCCATTGCTGTTCTGGCTTAGAGCTTGGAGAGTGGTGAGTAAACATCAAT
CTCATTGTCTGTGTTGTTGCTGCTGTTTTGAAAAATACCTACTGCATTGTTAAATGCCAT
CAGAGCTACACAATGGTTATGGTGACCGCTACATATAATTTGCCCTGTAGATGGGCCTCA
GGAATGTTATTTACACTTTTCCTGTCTTTTTTGATTTAATTAATTTATTAATTATTAATT
TATTAACCAGTGCACCAATTGTGGAGGAAGGAGACAAGTCTTGGACCAATGANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved