Cavia_porcellus Locus Poly:10:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:10:SNORA2
Cavia_porcellus
Poly:10:SNORA2
scaffold_233641
SNORA28, SNORA2
1001..1126, 4681..4817
4878
AGCCGTTCTGTACTACATAGTGAGATCCTGTCTCAAAAAACTAAAAACTACCCCACAGT
GCAAGCAACACTCTGTGACAGATTATCAAAATAGTCTGTCACAATTTGAGCTTGCTATAG
CAAGAAAGTCTAACCTATTCCGGCACTCTCCTTTCTGTGAGACAAGCCGTTACATAGACT
GAAACAAGTTAAAAAAAAAAAAAAAAGAAAACTACCCCACAAAAATCACAGTAGCCACAT
TAAAACAGGAAGGAAAAAAAGATAGAAAGAAAAGTAAAGGAAGGAAACAAAAACTCAAAC
CAGGTACATTTAACTTTAGTATATTTTATTTAACCCAATATATTCAACATATAGCTCCAG
TCTGTTTTTGTTACATTTGTACCTGAATAGTAAACAATTTTGGAGCTGTATAAAGGATAT
TTTTTAAAATGTTGGAGGTGTCTCAATTGTCCATTGCTACTATATAGAAATATGATTGGC
GTTTGTGGGTTGACCTTGTAAATGTTAGACTTACTTGTTGGTTCTAACAAATTTTCGGAG
GTTCTTTGGGATTTTTTATGCAGATAATTGTTTTATGCAAATAAGGATAGTTTTATTTCT
TTCTTTCCAATCTTTTGCCTTTGTTTCCTTTTTTCTTGCCTTATTGCAGTGGCTGGAATT
TCCAACGCAATAATTGCATTAGCAGTGGTGAGGGGGCGGGGGATATAGCTCAGCAGCACA
GCTTATGCAAACGCAAGGTCATAAGTTCAGTTCCTGGTACAAAAGAAAAGAAAAGAAGTG
ATGAGAGTGGACCCTTTGTCTTGTCCTAGTCTTAGGGAAAAAAGAGTTGGTTTTTCCTTT
AAAAAAAATTTTTTTTTTAAATTTAAGTTTTTCATCCTTGATTCTGACGTAACTTGTAGA
GTTTTTGGTAACTGCTATTTATTATGTTGAGGAAGCTCTCTTACTAGTTTGCTGAGAGGT
TTTGTTTTGTTTTGTTTTGTTTTTGCTGAGAGTTTCCATCACTGCTGAATATTACACTTT
ACAATTTTTTCTGTAGCAATTGATATGATCAATGAAGTTTTTCTTAAGATTACTAGTAAG
TGCATTATGTTGACAAATTTTTGAATACTGAGACAGCCTTGCATTTCTGGAATAAACTTT
ACTTGCTTGTGATGTGAAAAAAAGGAAAGAAAGGAAGAAAAGAAAAAAAGAGGCACAAGG
AAAGCTTCAGCTACATAGTGAGCTCATGAAGTGCCCGGCCTCACAAAACAAACAAACAAA
TAAATGAAATAAAAATGAGGTGAAAGCAAGTCAAATAAGTTTTTGGATGCGACAAAAATA
AATAAATAAAAGGACACAAGATTAAGGGTTTCTGAGGCTGGAGGTGGAGCTCAGTGATGG
AACAGTGTTCTGACATGCTCAAGGCTATGGTTTCAGTCTCCAGCACCACACACACACCCA
AACACATGCACACACACACATATGCCTGTGTAGGCATACATACACGGGCTTTCTGGAGGA
GGGACTTGATGGACTCTGGAGGTCAGTCATGGCAACGTTTGTGAGCAAGAGGGTTTAGTA
ACAGAGGAGTAGTATCAAGCCAAGTGTGGTGGTGTAAACCTATAATCTCAGCACTCAGGA
GGCTGAGACAGGAGGATCACTACAAGTTCAAGAGCAGCCTGAACCACATAGTGAGAGCCT
ATCCTGTATTAAGTAACAAAATAGGATTTGGGAGGTAGCCCACCATCCCTGTCATCCCTG
AAAGCCTGACTGTCCCAAAATGTTATCACTGGAACCTTACTTTTTTGAGTCAAGGTCATA
TGTCTCTTGGAGAGCTAGCTCCTTGGTCTCTCGTTTCCTTTTGTTAGGGGTGCTGGGGAT
CCACCTAGGGCCGCATATGCACTAGACACATGTTCTGCCACTGACTGACACCCCTAGTCC
AGTCATTTCTAAGTGGACCTTGGTCTACTCAGGGAGGACACAAGGCATGAAGAGTGAGCA
GTGCTACCTGAGCTGGCTCTTTGGTGTGGGCTTCTCAGGTGCAAACACAGCCAACAGAAG
GCTGTGGAGCACCGAAAATAGGAGCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTTTTTAATAAAACGTACAAGGTG
CTTAAAATACATACAAATTTCTTTCATGTCTTTAAAACCAACTTGTGATTATTTGCAGAT
GACATGATACCCTACAAAGATGACCCCAAAAACACCACTAAAAAACTGGTAGATTTAATA
AGCAAATTCAGGGTTGAGGATTTAGCTTTGTGGTATAAATGCCTGCCTTGCAAGTATGAG
GTCATGAGATCAATCTCTGGTACCAAAAAAGAAGACAAAAAAAAAAAGGAAATTCAGCAG
GGTAGCTGGATACAAAGTCAACACTCAAAAAAAAAAAAAAAAAAAATCAATAGCCTTAGC
CAGGTGTGGTGGCATATGCCTGTAATCCCAGCACTCCGGAGGCTGAGGCAGAAGGATCCT
TGTGAGCTTGAGACTAGCCTAGGCTACAAAGTGAGCTCAAGGCCAGCCTAAACTGCAAAC
TGAGACCCTGTCTCAAAAAGAAAAAAAAGAAAATCAATAGCTTTCCTGTACATGAATAAC
AAGTCACTGAGAAAGAAATTAGCTGGCCCTGAATCAAGGCCAGCAGCTTTCTGACTCTGT
TGGTTTCAAGCAGGAGCCTAAAGAGATGTCTTTCTATGGTCTTTTGGCCATTTCAGAACT
TAGGCAGTGAAATGGTCAATTCATCAGAAAGAAACAGCTTGAAGCAACCTCCCCCCTCCC
CTGCAACCCCCTCCCCACCCCCATAAGCATAGCAGGCAGCAGTGGCCCAGGACAGGAGTC
ACCAGCATTTACTAGGCCTGTTTACTGGGACCCGTGCCAGGCTGGGACCTGGAGCACCAG
GAAACCAAGCAACCCCTCGCCACGTCTGTTTTGTTTTGCTGAACTTCAATATACATGAAA
GTATGGACAGCTATTTTGAAGAGAATGAGAGACTCTATGACAGCCATTAGTGACTTCCCT
ATTGTCTGGTTTTGAAGACCTAAATCGCCTTCCTCATTCAGTTTGGATCAGTTTTATACT
ATGTTGTTTTGTATGAATTCTCTGTATGCGAAGACATGGACAGTTATTTGAAAGAACACA
AGAGACAATATGATAGACAGTGAAGATCTCAGGTCGTCTAGCTTTGAAATTTGTATCTCT
TACATTGCTTTCTTATATCCTATTTTGTTCTGTTTTGTTGTGTTTAATTTTATCCCCTTT
AAAATAAAAATTAAAAAAATTTTTAAAAAAGAGAAAGAAATTAGGAAAACAATCCCTTTC
ATAATAGCATCCAAAAAAAGAGAAATATTTAGAAATCAGGAATGAAGGATGTAAAAGACC
TCTACATTGAAAACTACAGTACTTTGAGAAAGGAGATTGAAGATGACATCAGGAAATGGA
AAGCTATCCCTTGTTCTTAGGTAGGGAGAACCAATATAGTGAAAATGGCCATACTTCCAA
AGCTGTTAAACAGATTTAATGCAGTTCTGATCAAAATGCCAATAGCATATCTCACAGAAT
TAGAGAAAACAATCCTAAAGTTCATTTGGAACAAGAAGAGACCTATTATAGCAATTCTGA
GCAACAAAAGCAAAGCAGGGAGCATCATAATCCCTGATTGAAATTATACTACAAAAAAAA
TTATACTACAAAGCTATTGTGATACAAAACAATATGGTACTGGCAAAAAACAAAACAAAC
AAAAACCCAGACCCAAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved