Cavia_porcellus Locus Mono:565:SNORA73
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:565:SNORA73
Cavia_porcellus
Mono:565:SNORA73
GeneScaffold_6579
SNORA73
1001..1204
2204
CATTCCTTGACGTCGGGACCCGCCACGAATTATAAATACGACTGCTTCGGGGCTTACTC
CATCTTTCAGACAAAGGCTAGCTCACTTTTTTTCATCACGTTGGTGAGTGCTTTTACCTG
CCTGATTCATTTGCTGTAGATCTTAGCAACTATCCTTTCTTGAGGCTATTATTTAGAACA
GATGCCTTTAGCAGCGTCCAAACCTATTAGGCTTGAGTGAAGCCTGAGCAGGACGTAGGC
TGCTGAAGAATCGCTACCGTGAATACCCAAATGCCCACGGGGCCTCCTTTCTCCTCCAGG
ATGCTAAGATTATAAGCATACTGCTTCCTGGAGGGTACATGTCCGCGAATGGATCTCTAC
ACGCGTATGTTAATGGGCTTCCCTTTATGACTAAAAATTAACACTTAAAAGATCAGGCTT
GGTGGTACATGCCTACAATCCCAGCACGCTGGAGACAGAGACAAGAGGATTGCAAGTTTA
AGGCCAACCTGGGCTACATAGTTCAGCATTGTGAACTACATAGTGAGACCTTGTCTCAAA
AATATTAATAACAATTTGAGGGAATATGAAGACTCCATGATAGAATTTAGGATGGGTGAA
CGAGTTACCTCTGCTTTAACCATTACCTTCCACTGAGTGTTAATATCACATTGAAGTTCC
TAGATAAATTTGCTGAAAGTTACCCTAGAGTATTAAATCAAACCCAGGGCATTTGTGTAG
ACCTGCATCCCAAGACCTTGTATTTTTTGTTGTTGTTTTTGTTTTTTAAGGTGAGGTGCA
GCTAAATTTCTCAGGATGGCCTTCAATTGTGGTTCTTCTGCCGATGATGGAGCATGTGCC
ATCATCCCTGGCTTGAAAATTAAGTTTGTGATAATGTGATGATCAGTTTGCATTTATTGG
GCTTAATGATCTATTATAATGTATCCTGGGAAAATCACTATCCACTAGATGAAATTTTTT
CTCAGCACAGTCTGTAAGTTACATGAGTTTCTCTGAGTGTCCCAACGTGGATACCCCGGG
AGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCATAGGGGAGCATAGGGCTCTGCCCCGTG
ATGTACAGTCCCTTTCCACAAGGTTGGAGAAGAAGCTGGGCCTTGTGTCTGCACCTGCAT
ATTCCTACAACTTCTCAGAGTCCTTTGGGCAGTGACTAAGGGGATAAACTGTGCAGAAAA
CAATGTCTAGTCAACTTAAGACTTTAAGTTTGAACTATGGGACCAGGGATTTAGCTCAGC
AGCACAGGCACCTGCTGGCAGGTACAAGGTTGTGAGTTTGATCCCCGGTATCAAAAGTAA
ATAAATAAACAGAAGCACAGAGGACAGTTTTTCAAGAGAGCCTTGAGTCCCTTTTAAGCA
ATAATTGTCTGTAGGAATCATTTGTTTAACTGTTCTTTGTCTGCCTAAAAGATAATTGCA
GTGGTTATAATTTACAGTAAATTAATAACATTGATCTAATGTAGAAATATACAACTAAAC
CAATAGGATTTATATTTGTTCTATGTGAAAATGACAGGGTAGCTGGGTACAGTGGCGCAT
GCCTGTAATCCTAGCATTTGGGAGGCTGAGACAGTATGATCATTGAGAGTTCAGCCTGTC
TGAACTGTATAGCAGGACCCGTCTCAAGAAAGAAAAAGAAAAGACAGACAAAGACAGAGA
GAGAAACAGTAATTGAGGAAAATTGAAAGATGCAGTTAGCTACCATTTGCTTTTTGTCCA
TCTGGCTTATTTTTGAGTACTGAATACATGTTACNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved