Cavia_porcellus Locus Mono:62:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:62:SNORA2
Cavia_porcellus
Mono:62:SNORA2
scaffold_224108
SNORA2
1001..1126
2126
GTGAAATGGGTTTCCTGGTCAAAGATATTGCCATAAGTTACCACCCTGTAAGGTGCCCT
ACCTGTCAGTCCTGGGCCATCCAAGCTGGTAATCAGAGTGTCAGCCCTCAAAATATGGGC
CGACTGTCCATATGGACATGTAAGGGACCATCTTCATGTATTATAAATAGTCATTCTATC
CACAACTCTGCCCATTGTATAATCTGCCTGTTCTGGTTTCAAACCAGAAGATTTCCATAC
TAGGCTGGAGAGTGACTGCTGTCCACTGTGGGGCTGTGCCTTGGCTAGACTTATTAGTAT
ACCAGGTGTCAGCTAGAGGTTCCCTTTTTTCTTCTGGTTAGGGGCTAGGGTCATGTCCTG
TAGGGCTAGGGTTATACTTGTGGTAACTGCCCTCTTTAAGTCTTGAAAAGCAGCTTCCAC
TATGCCTGTCAGTCTCATGTCACACCCTTCCTGGTCATCTGGTGTAAGGGATGCAGCAGG
GTAGCCGGATGCAGCATAAATGTCAGTCAGTTAAACCTGGCAAGTTCACATACACTTGTT
ATTGGCATACTGTCACGGGCCTGGAGTATATCTGGATCTGATCAGTTATGGTATCAGGAG
TTATTTTTGTCTACCTGGCCAGCTAACACCCAAGAATTTGACAGACAAGCCAGATTTCTG
TTCCTTGGACCTTGTCTTTGTTCATAGCCCATCCTCAGGACAGCAAAGCTTCCTTCAGAT
TGTGTGCAGAAGCTTCCAAATCCGTAAGGCAATCAGAGGTTAACATGATGTTACCAATAT
AATGAAGCAGTGATACAAAGTGTGGCTTGGTCCAGGTGTCCCAAATCCTGAGACACCAGG
CCATGACATAAGTATTACCACAAGACATGCAAATAGCCTTGTGGTAATACTTGGAAGGTC
CATTACCTGTCCTCCCAGGGGACTGTGTGGTGTGATAGCAATGGAGAAAAATGCACTGCC
AAATCCACAACATAATGGTACTGACCTACTGTAAGGGTAAGATGATCCTGGCAGTTTCCT
GATGCTGTTGGTTTCAAGCAGGAGCCTAAAGAGATGTCTTTCTATGGTCTATTGGCCATT
TTAGAACTTGGGCAGTGAAACAGTCAATTCATTAGAAAGAAACAGCGTGAAGCAATCCTC
CCCCTCCCTGGGAGTGGCTGTGAGCATGGCAAGCTCCAGCAGCCCAGGACAGGAGCCACC
GGCGTTTACTGGGACCTGCGCCATGCTGGGACCTGGAGTACTGGAGTGCAGGGAAACCAA
GCAACCCCTCTCCTCCACCTGTTTGGTTGAACTTCAATATACATGAGAGTATGAACAGCT
ATTTTGAAGAGAACAAGAGACTCTATGATAGCCATTGGTGACTTCCCTGTTTTCTAGTTT
TGATGACCTAAAACGCCTTCCTCATTCTGTTCGGATCAGTTTTATATTGCATTGTTTTGT
ATAAAATCTCTATATGCGAAGACATGGACTATTTGGAAAAAAACAAGAGACTATGATAGA
TAGTGAAGATCTCAGGTCATCTAGCTTTGAAATTTATATCTCTTATATTGCTTTCTTATG
TCCTATTTTGTTCTGTTTTGTTGTGTTTAATTTTACCCCCTTTAAAATAAAAAAATAGGA
TGAGATAGTCATCAAGTCAGCAATATTAGGCACTGCTTCCTGTTATGGAGGACTCACTTC
CTTCAGTTCCCAGTAATCCACAGTCATTCACCATGTCCTGTTAGGCTTCCACCTGGGCCA
TATTGGGGAATTGAAAGGGCTATGTGCAGGATTGTGGTAAATAACTGGAGGTCAACTTGT
GATACCAGCTGAGCTGAATCAGTGTGGTGCTGAGTGTGGATGGCCCACCTGAGAATTGTT
GCTAGGGTAAAAAGGAGAACTGGATAGGAAGGGGTATTGTTGTTGGTTCTCCATGGTGCT
GTTAGTTTTCCTGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved