Cavia_porcellus Locus Poly:25:SNORD113
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:25:SNORD113
Cavia_porcellus
Poly:25:SNORD113
GeneScaffold_6939
SNORD113, SNORD113
1001..1072, 5859..5934
6237
AAACTCCAAAGTTTGAAAGATCTAAAATCTGAAGCAATTCTGGTCCCAAATGTTTTGGC
TGGATCACAGATGCTTAGCCCGCACCGGTTCACGCGCGACTGTGTGTTAAATAGTCCCAT
GTCTTCGTGCTCAGAGCACTAATAAACACCCGTGAGTCCTCACTATTTCCATGGGCCAGG
CTACAGGAGAGGCGCAGCCGCCAGGAGGTGTAGGGCTCCTGTGAGTTTGCAAGCCAGGGC
TCAGGGCTACCTGCTGGCATCTGTCTGGGAGACTGCATTGGGCCTCCTTTCCATGCCTCC
CCTGTGTAGCTGGCTGTGGGTGGGATCACGGTCTCTTCCCTTGCAGAGCTTTCCCCCGGG
CATTGCAGGAGCCTGATGCGGGACAGTTTCGTTCCTCCAGAGCAATTGAGCTAAGACAGA
GGTGGGACCCTTGATGCATTTGTGACCCCACATAACCCCTGCTGCTGTGGTATTCTTGGT
CATGTAGGCTGTTGGGTATCATGGAGGTCAGTGGATACCAGGAGCCACGGAATGCTGGCT
CCATCTTGGCGGCTGCTACTACATGTGCTACCTTAAAATATGGACAGGTTAAATAACTGA
AGGACCACGACGGAGTAGTGTCAGTGTGGGGACGAGGTGTGAAGCAAGGGAGATGAGAGA
CCTGTGTGTGGAACTTCAGATCATTGCAAAGATGCTGTCTGCTCTTTGGAGAATAAGTTG
TAGCGACATCTAAGGAATACTTAGGGTCTTAGTGTCAGGTTTGTGCTTCATATATCGTGG
CTTTGTTAGTGCTGATGGCTCTGAGTGCAGTGATAGATGGAAAGAGCCAAAGCTGGACAT
GGTGGTGCATGGCTATAATCTCAGCTCTCTGGGAGGCTGAGGCAGGAGGATTGCAAGTTT
GAGTCCTGCTTGGGCAATGTGAGACCCTGTCTCACTTAACTCTGTGCGAAAGTTTTTAAT
CTCCAGTATTGTTTGTGTGGGGGGAAAGCGTGTTCTAAGCCTAGACAAATGATGTGTATT
CTGGGGTGTCTGAGTCAATGATTTTGGTTAAGCCCTACAACTCTGAGGTCCACCATAAGC
TGGATGTGGTGGTGTATGCCTGTAATCCCAGCATGGAGGGAGGTTGAGGCAAGAGGATCA
TGAATTGAAGCCCAGCCTGATAACTTAGTGATTTAGCAAGACCCTATCCCAAAATAAAAA
ATAAAAAAAGACTAAGTGAAAACTCAGTGCAGAGGGCCCTGGGTTCATTCCCACTCCCAC
TACCCCCAAAAGACTGCGATGTCACTGACCTCTAGGCTCAATGATCTTACAGCAGATGCA
CATGTGGATGAACAGAAAAGGGACGCATGTGACACGTGATGAGTGTGTAGGGGTTTTATT
ATTACTGATACACCCCTAAGGCTGCCATTTCCGGTANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGTAGGGGAATTTGGGATGTAGCTCAGGGACTGTCCCTGGGTT
CAATCCCCAATGTTTACTAAATATCTAACTATGTATAAGTGATAATAATTAGCAGGAGAA
ATATTCTATTTTTGACTATGTTGGTAGAGAATACATAAATGATTTCTTATAACCGTCATT
TCTTACTCTTGTGTAGGTGCTAGGTACGTCAGTTAAAATGTTCCAGGACATTTGTGGGCC
ACTAATTACAACGTAGCACAAATTGAGGTTTAGGATTAATTTGTGCAGCCCTATGGAGCT
CCCTTGAAAGGCTTCCATGTAGGCTGCATTTGCTTAAATCTACTGTAATGCCACACTGGG
TTTAATTATTCTCCAATTGTGAAAATCGTAGCTGTTATTTCTGTGGATAAAGAGCGTAGG
ACCAAATGTAAATAGTAGTCAGCCTTTATGTTCTGGTTTGATGCATTTTCCCTGCATGTT
ATTGTTTTAGAGAAATAAATCAGTACCGAAGTAAACAAAGTTGTAGTTTGCATCATCCTG
TGATGGGTCAAAACCAGAACCATTCCACTCTAATATAACGCAACTTCCTCTCTTTCTGTC
TTTTGAAGAAATCATCTACTTGCTTTCATTTCTGTCTTGTGTGAGGTGTTTCCTGTTGGT
CCCATCTGGCCATGATGCTCTCTGTTTTAGGGTATTAGTCATTCAAGTTCTCTAACTGAT
ACAGACCTGTTCAACTAGCCTTTCTATATGGATTTCTGTAGTAATGTACCTTCCTCACTT
CAGATACTAATAATTTACACCTTTTCCTTTGAGTCTTCCAAATAATAGCTTCTCCCCACC
TTGATTTCTCCCCAGTGATAATCTATTTGCAATCTTACTGATTTGTGTTCTAAATTTTAA
AAAATTCTACTCATTTTGTACTTAAATTTGCTATTCTTTCTATAGTTTCTTAAAGAGGAG
CACTTAGATGGTTGACTTCTTGGATCTGAGTTTTAGGTTGATGTTTTTAATTGACAAAGC
ATGGTGTTGTGATCTATGCATACAATTTGGGCGATGAAATCCGGCTAACCAATCTGTCTC
TTCCCTTATTACCTATCACTTTTATTAGTAATTTTTTTGCATTTGCTCTCATTGTTATTC
TGAAATACACTTTGTTGACTGTGGTCTCCCTCCTGTGCAGTAGATCTTCAAAACCCCTTC
TGTCCTGAGTCTTTGTAGTCTTTGACGTAAGCCTCCACACAGTCTCCATCACACCCACCC
CCAGCAGCCAGTTACCGATATTCACTGTTTACTTCTGTGAGTTCGATGTTTTTAGACCCT
ACCTACGTGAGCTCGGCTGGGATTTGTGTCTGTGCTGGCTTATTTCACTTAGCACAGTCT
CCTCTCCATGTTGACTCAGGAGGCAGGCTTTCTCTCCTTGGTGAGGCTGAATGATGTTCC
ACTGAGTACATGCACCACATTCTCTGTATCCACCCATCCCCTGACGACATTTTGTTGATT
CTGTGGATTGGCTATTGTGCATGTTTAAGTGAGCATAAAAATGTAGGGTGTTTTTCCGTA
CTGATTTCAGTTCCTTTGGATATATTGATGAGATTACTGGATCATATGGCAGTCTGTGGG
GTTATCTTGATTTTTTTCAGTGTTTTATAGTTTTTAGTATACAGGTTTTTCATCTCCTTA
GCCAAATTTACCCTGTATATTATTTGATTTTGAAAATTGGATTTTTAATAAACTTTTTTG
ATAGTATATAAAATTAGTAATTATTTTTGTTTTGATTTTGTATCTTGAAATTTCACTGAG
TTCATCGATTTTCTTTGTCCTCTCCTTTGTTTTTCTTGAGACAGGGTCTCAGCCTGTAGT
GCTGCTGGCCTTGAATTCTCTTATGTAGCCCAGCCTGGCCTTGGACTCACTGTGATCCTC
CTGCCTCAGTCTTCCAAGTGCTGGGATTACAGACATGCACCACCACACCTGGGTGTTTAT
CGGTTTTAATGGTTTTCTGTCTTTTGTAAGTTGATGTAGGATTTGGGTTTTATGTAGCCA
ATCATGTTGCTGGCAAACAGAGACAGTTTTGCATTTTCCTTTCCTATTGAGATGCATTTT
ATTTCTTTAATCTCCGTATTCAGTGATGTTTCCCTCTACCCAGTTAATTTTGTTGTATCC
CATTTGTTCCTTTTCAGTTAAAGGGGAAACTTTACACAAATGGGCCATTGTATGTGCATC
CAGTTGAGCAGGGAGCAGTTCTGGGTGCACCTTGATCATGTGTCCTATGAGAACAGTTCA
GAATGATCAGGTTGAGTTTTTATGAACAACCCCCAAATGACCTACTGGGTCAGTTATTTG
AGTAAGGAATAGATAGTGCTGTTATTGCTACGCAGGTCTCATTTGTAGTTTCTTTGCAGT
CATTTCTGTTGAATGAATCAGTAAAATGATATATATGAAAGGAAATTACAGATCAATGAC
AATTATGTCTTCTGAGAGAATGGTAATTATTAGTTTGGATTTTTACTGCTAATATTCTTA
AAGTTATATAATATACATGCAGATCTTAGCACACAACAGTGTTTAAGTTCTGGATGAGTG
GCTGAGTCACCAGTTTGACTATTGAAAAGAAAAATGATCAAATGAATCCACGAACAATTA
AATAAATGAATGTACGAGGAAGACTCAAACAGGCCACTTTTAAACCAGAAACTGGAATAG
AGGTTTAAAAGTATGCAAACTTAGCAAAATTGGGACCCATTAAGATGGTTTTTGTTTTGT
TAAAGCTGTTAAAACAGAGAAAATTTTCATAGATAATTCTTTTTTAGTTTAGTAGATTCC
ATGGTATTTTCATTCTGTTCTTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCTTCCCACAGAATGTCCATAAGAGCTGACTTATTCAGCTGTTCTAAGA
AGCCCAAATCTTGGCAGTTATTCTGTGGGCAAAGAGCATAGAGAATAATGTAAGTAGGGC
CTCCTGTGCGAGTCCTGTGGAATGCTTGGTTCCTGTGTGTGGTTCCTTTCAGTGAAATCC
ATGTCCATGAAAGGCACAAAATCTCTGAGCTCGGACCAATGATGGGAATGTGTGATGAGG
CAAAAACACATTCGATCTCATTTGGAGGTGATTTAGGCATAGTTTTATTTTCAGAAACAT
ATTTTATTTCCTAGCACAGCGTTTCCCTGCTGATGTGATCCTGGTTGCTAACCCCTCATA
TGATAGCCTGAAAGAATGTGAAATCTCCCTTGATTGTTTGAAGATGGTGGTCTTATCTCT
TTTCATTGAACCATCTTTAAAACATGGGCAAATTGAGGACTGATGGCAAAGGCAGATTTG
CTAATTAATCTCACACATTCTCTGAGATCTGGTGTGAGTGGAGATCCAGTCTAGGAACTA
AGAACAACCAACCAATGGCAAAATCTTGTTCTTAAATTTTGTGACTATCATGTTATTCAT
GAATGAATAAATTAATCAGTGAAGGAAGAAAAACGTGCCTGGACCCGTGATGAGTACCAT
GGGGTATCTGAAACAGGATATTTTGATTAAACCCGAATGGATCTCTGAGGTCTGTTACAG
AAAGACATGTAATTTTTCCTTCTTTGGAGAATGAGCCCATGCTACTATGTCCTATGGCTT
TCAGTTTTTTGTGGATGGATTTTACTGTGTGTGTGTGTGTGTGTGCGTGTTTTGTGCATG
TGTGCATGTGTGTGTATGTATACATACGTGCATGTGCAATACTGGATTCAAACCCAACAT
CCTTCTATTCCTGAGTTATACCCTTATTCTAGATTTTACTTTCATTATAAAGTCAGCTGA
TGTGTAAAAAAATGTATGCATGAAAAAAGATCAAATCATGCAATTATTATAAAAGAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved