Cavia_porcellus Locus Mono:695:SNORD45
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:695:SNORD45
Cavia_porcellus
Mono:695:SNORD45
GeneScaffold_3585
SNORD45
1001..1079
2079
TTGAAAATGGGCGCAGGCAGCGAGGACACCTATGAGAAATCCTAAGGGTCCTGCTTCGC
CCTTCAGGCGAGAATGTAGTCAGCTATGCCTGGCGTGGAAGGGCCCTGAGGAGGGGCGTC
TGCGCAGGCGCGCGGCTCCTAACTTTACCCAGGGGCTTGCTGGGTTCTGTCTCTTTGGCT
CTGCGACATGGTGGGTATAGGTTGTCCCTTTTGGAGCTGTCCGAAGGGGTACAGGAGAGA
CAAGGTGGTGTGCTGTTGAGTGCTTTGGTCGCCATATACAGTTGTCTGCTGAGTATTAGA
GAGTGATTAAATTAAGACGCGGGCCTTGGAATGTTTGTGAGAGCTCGGAGAATGTATTAC
TCAGCGTTCCCTGCAGAGCTCGCCGCCTTAGTAGCGGCTTCTAATTTTGTGTAGGCTTCT
TCCTTTTGGGCGGGCCTGCTAGGATTTAGCGGTCCGATTTCTTAATCCTAAAAAGCCGAG
GCTGATTCGTTACTTATCCCATTCTATACATATATAGCTTTAAATATTTTACTTACATTT
GATTTTTGGCTCAAGGAAATCCAAAAGTCATTAGTAAAAACCTCTGGGTTGAAGTCTGTA
AATTTTAAATTGGATCGCCCGGAAATTTGCTGCCCGGTCATACTTGTTAATCGTGAGGAT
CTACTTAGTAACTGCAGTGTACTTTTAGTTACGAAGATGTAGGTGCGTGAAAACCAGATC
AGTACCTGTAGCAAATACAGAGCCTCTGGTTAGGGCGAACATGGGAGCCAAGACTGCTTA
CTGGTAACTTGTAATTTAGAGGGAGCACAGAAGTTCCCGTGGAACCTGATTTTTTATAAG
CCGAAATTTGTCTGCAAATTTTGGCTAGTCAGACCAAAAATAAAAATTTCCCTTTTTTTG
TGCGTTGTACGACATACTAACTTATTGGTAAGCTTTGATACTTTATAGTGTTTATTTAAC
TGACTGAAAGAATAAATATCAAATGCAGGTGGTAATTTTTGGGTCAGTGATGAGATGGCA
TGTATTCTGAATCTAAAGTTGATTATTACTGCTTTAGCTCTAGAATTACTCTGAGACCTG
AAAAATACCTGAATTTGGTTAAGTATTAGTACATTTAACTGCTTTTTTCCCGTGTGTTGA
ATATATGCTAAGAAGCAGGGATATAAAATGTGGCTAAAACACATCTTTTTATTTTGAAAG
GGCACGCCACAGAAGGATGTTACTATCAAGTCTGATGCACCCAACACCCTTTTACTGGGG
AAACATGCGGATTATATTGGCATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved