Cavia_porcellus Locus Mono:310:SNORA44
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:310:SNORA44
Cavia_porcellus
Mono:310:SNORA44
scaffold_216291
SNORA44
1001..1130
2130
ATTATTTACAAAGTGAATTTTCAAAGTGGAAAAACTATTATGTCAAACTACTCATAAGT
TTTTCACTGGTTCCCTATTTCATGGAAGCTCCTAGGCTAATCTGCTCTCAAGTTTGATTG
ATTTACCATCAAGTTCTTGAACACGTTTTCTATTTTGCATTGCCTTCACGCCTCATGGAT
TCTGATCAGCTTCTCCAATACTCCATTCACTGCATATTTGCTGAATGGCATTCATTCCAT
ACTGACATCTGTACCAAGCACTAGGAATATTGTAGGACATGATTTGCTCCTTGAAGGGCA
ACAGAATCTGGCAGAGGAACAAGATCCAGAAACAAAAACACAGCACAGAATGGTACTATA
GAAAGACAAAGGAGGATACGATGCCACAGAGAGCAGCCCTGATACCTGGAAATCTGGGAG
ATCATCCCAGAGCAGATGTTTTCCTGGCTTTGTCCTGCTTCTCCACCTTGTAAAAGTCAC
TGAAAAATCAAAATCCCTCATGTCTTATGAAGTGTTTTCAAATATTCAAAATATGGTAAC
TAGAACTCCCAAACTTTATTCTTGCTAAGACTGTTTTTAGGTTTTTTTTTTTATTTCTCT
ACAGGTTTTAGAATCATTAAAGCTTGAATCTGAATTTCTCTTCTTCCATTTATTGCCCTG
TTGTCTAGAAGAAATGACCCAAACCCCTCAGTGCCTTTCACTCTGGAACAGATGTGGTAA
TGCTACCTCACTTGGATGTCCCTACTTAGTACCATATGTAAAGAATATTCTGAGCATGAG
GCTGACATCAGGACTTCACAGGCAGTACCAGCAAATATTTATGCAATTATTACTTTTCAG
AAGAAAAGCTGCAATACAAATCCTATGCCTAACTGAATCTTGATTGCAGTAAGCTCTTAT
AAAAATAAGTTACATTATCCAAACTGTGGATACTTAGAAATGAATGTGCCCACTTATAAT
ACAATCACTAGGTGTTTTACATGATTTCAGAATCTGCCTTTCAGCATGATTTTAAGTTTT
GTATCAGATTGTGGCCAAGGGACCTCCTACTGACTGCCAGAGCAAACTGGAAAGATTCTG
ACAGCTTGGGTCAGCAGTATATCTTCAGTTTAATACACCTTTCTTATAAAGAAAAAAGAA
TAAGAGCTGTCTCTCCAGCCAATGCAAAGTGTGCTCCCATGACATGTCCCATGGTACTTT
TGTTTATAGTCACATCAACCAACTCATCATAACAAATTTAGATCAGACTATGATGCCACT
AAACAATCATCCAGAGGAATATTCCATGACCAAAAACAGTTCTAAACTTCAAGAGAAGAA
TGAGAGAAAACTGAAACCAATAATGAACATATTTTAAAAACCCAAAACATCTCCATACTA
TGCTATTGCAGGGCCAGGCTCAGCAGAATACTTAGTATGGATTTTAGTAAAAAGAGTAAA
GAATGTAGAAAAAATTTGAAGACAGACAAAGAACATCATGTGCTTAAGGTTTCCAAAGAT
GTTGGGCCTGCATGTTTTTGTAAAGAAACATCTGTCAGGGTTTGCGAACACTCAAGGGTA
CCCCTGTTTCATGTTGGAAGAGGTTGTGGAGTCAAAGCCCCCAGGCTAATTAAGCTGGAT
TGTCTGCTCCTGGGAGAAGCCAGAATTTAGCTGAGTGCCTGATGCTATTTTGATGCCAAC
TAACGAACTTCTGGATACTAATGAGACCCCACCATTTCAGAGCAGTTACATTCATTGGAT
TTAATCAAAACGTCTATCAGCATGTTCCCTATTCAAGGGTATCACCAGTGACTGCTGCGT
TCTGGAGCAGCTCTGCCTCTGAGCAAGCACACTGCTTCAGAGCTTTGAGTCCTCTCGGGT
TTCTTATTCCTGCTAATCTGTGGTGGATCTCAGCCACCTGGCAGACCCATCCATGGTACT
TCAGACATGTTGTATTTCTATTTTCTGTATAGGCAATCAAAAGCATGAAAACTCACACAG
TTTTTAATGCTGTGATTGCTTTGAAATTTTCATGGTAGAAATATAACTGCTCTTGCTAAC
TTCAGAATATAGCTACTCAATGAGCTCTAGCCAAAGACATATTCTCAACCCTGAACAAAG
CAAGCATCTCATTGTTGACTGCCCACAGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved