Cavia_porcellus Locus Mono:198:SNORA67
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:198:SNORA67
Cavia_porcellus
Mono:198:SNORA67
scaffold_199745
SNORA67
1001..1140
1785
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGACA
GGGAGCAGTCACGGAATCATGTTCAATCTGCTCAAGGAGGCATGGGGTGCATCTGGGTTC
CTGCTCTACATCAGTTCACAGCTATGTTCTTCTTTGACCAAATTCACTAATGAAAAGAGT
AGATTCACTAAAGGAATTATCCAATCCCCCTAAGAGCACCTTAGAGACAGGTAAATCAAT
GTCACATGAAGGTGAACCTATTTAGTCCCCTTTCCTCCAAATGTGTCCTCCTGTTCAGTT
TCCAAAATGCAGTCTAAACCCTGTAGATGCCATGTTTCCAGGTGAAGCCAGTCTTCAGTT
GAAACTACAATATTTCTTCCTCTGCTTTAGTCAGTTTCCCTCACTCTCCTCTCTCATATT
TTATTTCCATGAGGGCACCGTTCTGAGACTGTGCATAGAGGCCATGACATGGAGAGACAA
AAAATAGTTCCTCAGATTGCTACAGCTTAAAAAGGAAGTTGAGAATTTCAAGGCATGGCT
TAGATCTGGATTACAGCATGATTGTTGGACGAATGAGGGAACTGAGATGATGGAATAGAG
AATTATGAGTCTTTGAAAGTGATAAAGACATCTCCAACTCCAGTCAAACTGACTTGATGT
AATTAAGTGGGTAAAACAAACCTTTAAAAGTTGGGACTCTTACCCATGGTGATTATCTTT
CCAAAGGGCCAAAAAGTGCCCTTTTCAGGGAAGTAGCAACGTGGAAGAAAATCTGGTATC
CTGAGGTCACTGAGTGAAAGATGATGTTGTTTCATTTACCTTTCTTTAGATCCCTACAGG
TAAAAAATAATATTGTAACTCTTAATTTTAGAGACAATCTACACTAGCAGCTCCTCTTGT
GAATAGTGTTATCAACATGCCAGCTCAGATGCATGGTCACAGAAATTAATGCTTGTAAAT
CTCATGCATGCATGCTGGTCTCAGGAGGTGAAGAAATGGTTTTGTTTTCACAAGAGAGGA
AAGTAGCTGAGAATGGAAAATGCCTGGTGATGAAATCAATCAATGTAAAAATATCCTCTC
ATGCTCTGTCTTGTTCTTTGCTGTCACTGCACCCAAGATCCATGTACACACGAATAAGAG
GAAATGGCATTTGGGGAAAAGGTCTCACTATCTTCATCAGAGGTAGATTTCAAGGATTTT
GTTTGTTTGTTTTCATTTTTTAATTTCCATAATTTCCATAATTTCCAAGCTTCTTGGGGA
GTGATAAGGGGACAATATTGCAGGTCCTTAACAATATATTGTCAGTTGTTAACAATAAAT
TATCCACTCTTATCAGATAGATCAAGGATACATTTGCCTTTGGAAATACAGTGGTACTTC
ATATCACAAATGCTTTTATTTGAGAACAATTTGGCTCACAAACAGAAGCATTTGGTAATG
TTTTGTTTTTGTTTTTAATTCTGCATCAGGTGACAAACATGATCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved