Cavia_porcellus Locus Mono:SNORA51
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:SNORA51
Cavia_porcellus
Mono:SNORA51
scaffold_1
SNORA3
1001..1131
2119
AACAGAACTAAGCCCACAAAAGATAAATATGAGAGAAATGACCCATAAAAAAGGCCAAA
TGAGACTTAGAGAGATGCAAAATACACGGAAAAACACATCTGATACAGTTAACAGATTAG
CTATAACAGGAAAAATAAAATGTGTGGCAATAAAGATGTAAGATTTTTAAAAAATACTCA
AGTCCAGAAAGAAAACTAGATGGAAGATGAGAATGGCATTAGTGAGATGTGGGACAAAGT
CACACAGTCCAGTACAAATACAACCAAAGTGCCCCAAAAAAGGAAGTCAGAAAAATTTAC
AGAATTTTTTTTTTATTTTAAAGAGGGTAAAACAAAACAAAACAAAGCAGATCAGAGGAA
AATAATGTAAGTGACACCCAGATATCAAAGCAAGACTACAGGAGATCAGCAGTAGCTACC
GTAATGTCTCTTGGTTTATTCTAAATAGTTGTCTATATCTTCACACACAATGGATTCATA
CAAAACAAAATAGTGTAAAACTGATCAAAACAGAGTAATGAAGGCATTCGAAGGCCTTCA
AAGCCAGACAATAGGAAAATCAACAAAGGCTACCTTAATGCAGAAATATTAAATGATATT
TTACTGATAAAAAAAACCCTCTATCCTCAGATGCAAGAAGTTCAATGAAATCCAGGCAGA
AGAGTTAAAGACAACTACAAAGGCAGATAGTCAAATTGCTAAAAACAAGTGAGAAAGAAA
AGCCTTAGAAAGAGCTGGAGCATGGGGAGACACAAAAAAGAAACAGATTTAACATGACAA
CAAAATGATTATCAGAAACTATATGGGGCAGGACACAATGAAATATCTCTGAAGCATTAA
AAGAGAAAAAAGTGGTTACCCTAGAATTCTAAAGAAAGAAGATGTTTCCAAGAATGCACA
TGAAATAAAAGCCTTTTTCAAAAAGTAAAAGCAAAAGATAATTTTTATATCAGCAGATGT
ACACTCAAAAAATTTTAGTGTTCTTCGGAGTTTAAAAAAAATGCCTCGTGCTGCTTACCA
CAGGCAGTGTTCTTACACTGATGTACAGAAAAGCGAGGAAGAGTAAACCTGCCCCATATA
CACGTTGTGCCTTGCCTGTATTGTAAATGGGGATACATGTGCAAAAAAAAAAAAAAAAAA
AAAAAAGATAGTAGATTGAAATTAGGATCTACAAAAAGAAGAGCTCAAAAAATTAAAAAA
ATATTTAAATAAATATATAAGCATAGAAAATTTTTCTAGCTTAATTCTACAAGATAGCTG
ACTCTATAAAGCAAAATTAACAATAATATAGTTTGAAGTTTATTATATACATAGCAACAA
AATAAATGCAACAAAAGTGGGATGCAAGAAATGGAGGTAGACTGTTAACTCTTATACTGC
ATGTTGGGTTACATTAAATCATGTAATACAGAGTATGATAGTAACAGGACACATTCTAAT
TCTAGAGTATTCACTAAAAAAGAGAACAGCTAGTAAGCCAAAGGCATAAGTAAAATGTTG
AATTAGAATTATAAAACAATTTAATCAAAAAGAAGGCAGGAAAAGGACATGGTCAAATAA
ACAAGAAAATGAACATCATGTATACTTCAGGGCTGGGGTTTACCTCAGCGGTATCAGCAC
CTGCCTGGCACGCATGAGATTGAGAGTTCAATCCGCGGTACCAAAAAAAAAAAAAGATTA
AAAATAAAAAAATATGGTATATTTCAGTCCAACCATATTAATAACTATATAAAATACAAA
TAATCTAAATAATCCAATTTTTAAAACAGTCACATTTTATTGCTTTAAAAGCAAGAGCCA
GCTGCATCTTTTTCCCTAAAAGAACCACATGTTAAATATAATGACAAAATAGGCCGAATA
TAAAAGAATGAAAAAACATCTGTTTTAGCAATAATAACCAAAGAAAAACTAGAGCGTTGC
TGTTTAGACCCAGATGTACTGCAAAAGTCGTGTGTGTTCACAACGGGGCTTTTGAAATGG
GCTGGGCCACGGAGGCACTAGTCCTCCTCACTGGATTACCCACGGATGACCCCATAACTG
AATGTGCTACTAGGAAGTAGGCCTGTTCAGAAGAGGCAGGTCATGGGGGTGACCTAGAAG
GGCCAATGTCCATCTCCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved