Cavia_porcellus Locus Poly:27:SNORD70
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:27:SNORD70
Cavia_porcellus
Poly:27:SNORD70
GeneScaffold_2234
SNORD70, SNORD70
1001..1086, 1740..1826
2826
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCCTCA
GTTTCCTGTTAAAGTGCTATATATGCTTGCTGGATAATCTGATCATGTGTCATGATGTAT
TCCTGTTGGAACTGAATCTCAGTGATCTAACTCAAATATTCGTCACTACCACTGAGGCAA
CAATGAATTAATTTTATATACTTTGTGTTTACTTTGTGCTTTGAGACAGGGTCTCACTGT
GTAGTTTAAGCTGATCTTGAAGTCATAGCCCAGGCTGGCTTTGAACTTGTGGTGATCCTT
TTGCCTCAGCCTCTCAAGTGCTGGGATTACACCACCATACCAGGCCTCATTTCTTTCTAC
ATGAAATGTTACCCTGCTCATAAATTTTTTAATGGATACATTGTGTAGTGGGTCATGTCC
AGCATTAAGCAGCAGGCCTTCTTTTGAAGCTTCATGTATTGTTGTCCTAAGCATCTTTGA
AAGCCTACAGCTTTCTTTGTAGGCCAGCATTTAGAAATCCAGTCATAGTATGAAAAATAA
TTAAGGTTGTATCCGATTCCCAGGGGCAATCAGGTTTCTTTTTTTAGTGTGTGCTTTGGA
AACACCCAGTGCTGCTTTCTCAGCTTCTATCTTTTGCAGCGTCACTGTGCCCCCTATAAC
ATGTTTCTTCTCTTAATTGTAGAGTAAAGCTAAAACATTTCGAGAAATTTCAGGACACAG
CAGAAGCATTAGCAGGTAAAGTCAGAAACTAGAAGCTTGCTTTTTTTTTTTTTTTTAAAT
CTGGGACTTAATCTTTCTTATTGAAATGGTTGTTTGCTTCAGTTGCCTGAGTTAACCTTA
TTCAATGTTGTCAATGATGCATCCTTAATGCAACTGAGTTTAAGTGATCTAACTCAAATT
CGTCACTACCACTGAGACAACGTTGAGTTAGCTCTTTTCACCATAGGCTGGTTTCCCCCA
TGTGATGAGAGGTGAGGCGTGGTTAAATTGATCTCCCTGTGGAAACCAGCAGCATAGTGC
TGAAGCAGTTCAGTAAAAGCTGTTCTACAAGGGACCAAGGTAATGTGGTCAAGTACACAA
TGTTCTAATTTAGCCCAAGACTAAAGTAGAGAAGAGCCAAAATTCACAGCTGAAAAAAAT
GCTAGCAAAGCTGTCCAGGAATACGTATTTTTTAACTCAGAAATCATATCACTATTATTC
AAAATTGTGGAGAATTGTTTTATACATGTACAAACTATAGAGTGCTATAAGAGTTTTATT
TATATAAAGAAGTGTGGATTTTTTAAATTTTAGAAGAGTGGATGGCTTTTATCCTTAAAC
TAGACATCATGTGGGACAATAGACATAAAGAGATACGTTTATTAACTATGAGCAACTTCA
GTAAATATTACAGGTTTGAATTTTTGTTTTTTAATAAGGAGTAGCCAAAAGAGGAAGGGT
GGGTGTAGTTTCTTAAATTGTTACTGCAAATAAGCCAACTCTCAGTGGTATAATTTGTAA
ATGAAGAACTGTAAGCAAAATTATGGATTACAGTTGGGGAGGTTTGACAGATGCAATAAT
TTTGTTATTCAACCACAGGTAAAGATAGGATTCTCAGAGTGAAAACTGGGAATCTGGAAA
AATATTCTAAAATATTAATAGGGCCAATTTCTTTGTCAACACACTAGTAATAGCAAGTCC
TCAGCCATAAGATACATTACTGTTACCCTGGAGAATTTTTTTGGGTGGGTGGGTACTAGG
GATTGAACTCATGACCTCATGCTTGCCAGGCAGGCACCTATGCCACTGAGCTAAATCCTG
GGCCCTCCTGGAGAATTTCTTAAAAGGCCTGCTTTGCTGCCACAGTGGGTCTGGGTGGAG
TTGTGGTGGGGTCCCAAGGAGCCTGTGTTAGCTGTTTTCTAACTCTAGAGGGCATTGTTC
ACATACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved