Cavia_porcellus Locus Mono:576:SNORA26
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:576:SNORA26
Cavia_porcellus
Mono:576:SNORA26
GeneScaffold_4034
SNORA26
1001..1117
2117
AATTTTTTTCCTGTTTTATTTCTGGGGATTTCACAGACGAGGAACCAATACCAGAGGTT
TTACCTCTCTCTTCCTGTGTCTTAGCAACAGATTTCAGCTTTACCCATCCTTCAGGCTGT
CATAACGGCTAATCTGTTCCTAACTGTATCTCCTGGGGAATATTTTGCCACAAGTATGAA
TTTCAGTTGTTTAGCAAGGAACAGCAGCATGGAGAGAAGGGCAAAGAAACAGACTTTTCT
AATTCGTAGGTTCTAACCAAGTTCCCAGCAGGCCTCTGGTCTCTCTCTTTGGTATTACTT
CTAAGTTGGAGCACAGGATTTAGACTTTTCAGAGTTCAGTGAGATTTGACCCTCAGTGGG
TCCTAAACTGCTGGCCATTGCTCTTCTTTTAGGCAAATGAGTTTAGGTTCAAGCCTGTCC
CTTCCCTCCAGCGTACAGGGCTTCCTCCTAGCATCTCCATATGTCTGTCAGTCGGTGTTT
GATTGGAGTTGGGTTGTACGCTCACCTCTGAAGAAACAGATTTCAGTAGTAAATGGAGGA
ATGGAAATATATGCTGAAGTAGACTACAAACTACAATCTTACCTTTATTTTAAAAAGAAA
TTAGTGTTGCATATACAATTTTTCAAAGCTAGAACTGTAAATGCATGATATTTAGGGACA
CACCCTGATTTTTTTGAGACAGGGTCTCACTATGCAGTTCAGGATGGCCTTGGGCTCACT
TTGTAGCCCAGGCTGGCCTCAAACTTGCAAGGATCCTCCTGCCTCAGCTTCCCAAGTGCT
GGGATCACAAGTGTGTGCCACCACACCAGGCAACACATCCTAATGTTTAAATATTGCAAC
GTTCTGGGTGTGGTGGCACATGCCTGTAATCCCAACATTCAGGAGGCCGAGGCAGGATGA
ATACCATGAGTTCAAAGCCAGCCTAGGTTGCACAGTGAGTTCAAGGCCAGCCTGAACTAT
ACAGGGGAATCCTGTCTCAAAAAACAAACACGCCCATTCCTGTGCCCCTTTAACACTGAC
ATAGTGCCTTAAGAAGCTAACACAGAAGGGTAAAGGGACCCTCCATAGAACCCAGAGAAG
AGACTGAAACTCTTTGAATCTTGTGTGAAGTCACAGCGGAATCAAACAAACAAACAAACA
AAAACCACCACCACCACCACAACAGAAGAATGATCTCAAATAGAATAAGAAATCAGAACC
AGAGTACAAGAGCTGGATGTGGTGGTGCACCCCTGTAATCCCAACGCTTCAGAGGCTGAG
GAGAAGGGTTGTGATTTCAAGGACACCCTGGGCTGTACAATGAGTTCAAAGCCAGCCTGA
ACCACAGAGTCAGACAATGTCTTAAAACTTGAGACAGCAGGCTTGATGTCAATCTAAGAT
ACATAGTGGTAACATCTTATTCAACTAGGATATGTTTATCAAAAGTAGGAAATTAATATT
TGCATATTATTAGCTAAATTAACTAATGTATCTTTGCATAGTATTAACTAAATGTAAGAC
TATACTGATTTTTCTCAACATTTACTAATGTTCTTTTTTTTATTCTAGGATCCAATCCAA
GATAGTACATTGTGCTTAGCCTGCTAAATTTTGAAACAGATTATCTTTGCAAGTAATATC
CAGTTAAACTATGACAATTATAAAGAGTGTGGCATTTTAATATTTAAGATAAACTGTTCA
TTAAGATGCCACTTGTATTGTGATTATGAGCTCCTCCAGGAAGAGGCTCTATTATTTGCT
TGGCACATTTTAGCTATATATAGTTTCACACATCTTCTCCAGGATGTGATCACAGCAGGC
AGAACTGAAAGTCTGAAACATTCAAGGCATTCTAACTTTTAGTGGAAAACAATCTCATTG
TTTCCTAATATAATTAGTAGGTTAGGATCTTATTCCCAAGACAGCTATAAGAGCTATATC
ATTGTAACTTATTAATACATTAGAAGCGTGACCCAAACATTATTTTCCAGCCACAGAAAC
CACAAAAGATCTCACAATCAGACTCTTACTCAGCAGACCTCTAGAGGGAAGAATGCTTGC
CAACAAAACCCAAACCTCTTTCTAGAAGTAACATCTGGGATAATTTGGGGGAAAGTAAAG
TTAATTTATAATTTTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved