Cavia_porcellus Locus Mono:627:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:627:SNORA2
Cavia_porcellus
Mono:627:SNORA2
GeneScaffold_6184
SNORA2
1001..1134
2134
CTTTGTCTGCATGTCCTCATGGGGGTTGGACTTAGGACTCTTGGGGGCTCTTAACTTGG
AATAAATCTTGGTATCTTTACTCTCACTGTGGGTTGCATTGGTGGTGGTAGATTGGAATT
AACTTGCTGAGATTCTTATAATGTCTCAGTGGGATTACAAATATAACCTTTTGGATTGTG
AGGAAAACTAGAAAGAGGATTACAATACTTGGATGACTGCACACAGTATTTGGGATTGCA
ATAGGCACAAAGTTGTGAGTTTGATCCCCTAGTACCAAAAAAAAAAAAAAAAATTTATTT
CAAGAAATCAATCACATCACAAACATCCTTAAAATTCAACAGTTTTCTATTCCTGAAAGA
TGCTTGAGAAAAATTTATTTTTCAAAGAGAAGCTAGAAATTGAAATGTTTTTGGCTGTCA
AATGTAGCATCTAAGATGAGAACTATGAGTTTGGGGAAGAGAAACTGGTACCTGTATGTT
TTATAAAACCAAAAATCCTCAAATGTTTTCCTTGCATAGGAGGAAAGTAAAGGCTGAGTA
GAGCTGGCACTCGTACCATTTGGCTTATGAATTAGACAAACACTGGATTAGCTGGGGTGG
TTCCGCTACGGATTTGTAACATATGTGGAACTCTTGAGATTATAGCACTCAAAAGTCTCA
TTTGAGATTATGGTCCCCAGTTGGCATTTTAGGAGAAACTGAGTCAGTACCTCTGGCCAC
AAGGTGGGTGTCTTAGGTATTTTTCTTGTCACTGAGACAAAATACCCAACACTCAAAGTT
AAAGGAGGAAAGGCTTATTTAGCTCAGTTTGTAGAGGTTTCAATCCATAATCAATTTCCT
CCAAGACAGGGTGGCACATGGCAGAGGACAACCTCACAGCAGTGAAAGACAGCAAAAGTC
AACAAGGTGTGGGGGAGACAAGACTCTTTCTGTGCCTTATATTGTATGTGGGTTACCTGC
TCTAGGGTAGGTATAGCACTCACCCCCTTAATCTTAGAATTGTGACCTTGAATCAAGGCC
AGCAGTTTGCTGGTAGCTGCTGGTTTCAAACAGGAGACTAAAAAGTCTTTCTGGGTCTGT
TGGCCGTTTTAGAACTTTGGAAATGTAATGGTCAGTTCATCAGAAAGAAATAACCTAAAG
CCCAGTGTGGCCCTGAGAAGAAGCCACACCCCAAGGCTATACTGCCATCAGAGGAGCACC
GGTGACGCCCCATGTCTCACCCCTCCAGGAACCCTGGATTGGAGAATCCAGGTGCCTAGT
TCAATCCACTGCACTGAGGATCTGGCAGCCAAGGCAGAAAATGCCCAGGATGCAGCAATG
GGCTGTCTTGGAGAAACACAGGAAAATTTTAAGATGAAGGAGCAAAATACAATCCCATAC
CTCCAGCCCACACAGAACAAGTTAAGGTGGACACACAGTAGAAATTAGAGATCACACACT
GAAATTTCAACTTAATTCTTGTATTGTTAATTTTACATTCGTATGTCTGAAGGTCTGAGT
AGCTATTTTTAAGATAAGAGGCATTATGGTAGTCATTGTTCATTTCCTATTATCTTGTTT
TGAAGTCCTGCATTGCTTTGTTTTGTTTGGTTTGGTTTTAATCTCTTTAAAAAAAAAATC
TTAGAACTATGCCAAACCAATTAACAGACCAATTTACTAATCATGCACTCTTGATTCATT
GCCCTCTGAAAATGCCCTGTTAGTCTTTGAGGGACCATCTAGACACAAACTATAACAGTA
GGGGGCAGGTCTAGAATTAAAAGGAGCAAACCTCAGTTTCCTTTGCAGGATACTCAAGGT
CTGTGTGAGGTGTCTCTTGTCTACCCAAACAGCTTCATCTCTCACGATGCCTTCAACTGC
CTGGCTGCTTAGCACCAAGCCTTGGCTGATGCTGCTGTCTACTGGAACGTCCGCTCTTCC
CGGCAAGTTCTCCCATCTTATAAGTGATACCCACTTGATGACTGTTTTCCAGTCATGTCC
ACAGCACAAACTGGCCATTTCCTCCACTAAATCCTTCACTGCCTATCATGTGCTCTCTGA
TGGACCCTACAATTTACTGCACTTTCACTTCTATGCATTTTTTCATCTATCAGTCTGAAA
GAAACCTCAGGGGAAAAACGGTCCAGTGTGGTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved