Cavia_porcellus Locus Mono:717:SNORD60
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:717:SNORD60
Cavia_porcellus
Mono:717:SNORD60
GeneScaffold_6173
SNORD60
1001..1085
2085
AAAGGTTTTTCTATTTTACTTCCTCCATCTCAAAAGTGAGTCTATACAAGCTCATGAGA
AACACATGTAATGTACCTGTAGTAATTCAGACACAGAAGAACACATAGCGCCAAGGTCAG
CTGTCCCCCAAGAAAAACCAAGGACTGAAAAGTTGAAATGTCTCCAGCGGCTATTGGGCG
ATTTGCCGTTCTTGTGACCTTAAACAGAAGACACAGACAGATGCCTTAGCCTCATGCATA
GACACTGTGGCTTAAACACTTAGTGAAGAGACTTTCTGTGGTACGCACTGAGGCGCAGAT
ACAGTGGACAGTTAGGGGAATGACCTGGGTTATGACGTGGATTGCAGGGTTTCCAGGTGG
GCTCAAAGGTAGATTTCACTCTGAGAGTTCTGGAAGGAACACGACAACATCCTCTCCTGT
ATAGGGTTAACTGAAAAAGCCTGGGCCAATGTCCCTCTAAGGACACCGAGATCTCTCATA
TACTGGAGAGACTCTGAAGGCTGTGTCGAGGGGCCTCAGCCTTCAGCTGACACCGAGTTG
AAACCAGTCAATGGGTTTGTAAATCAAAGGCCCACTGCATAAGTAGAGTGAAATCAACAC
TTAAGTGCCCTCAAGAATGAAAGTTGCCTGTTTGCTTGTGGTTGGTTCTTTGCCTTTTTG
AGACAGTCTCACTACACAGTTCAGGCTGGCCCTGAGCTCGATTGGAGCCCAGGCTGGTCT
CCAACCTCTGCCTGCCTCACTGCTCCTGCTATAAAGCTGCCCATTAACTTTTGGGATAGA
GCACAAGGGTCGAGTGCTTCTTCTCCGCAGATGGTATGTCACCATATGGGAAAAAGTCAC
ACGCTTAATGGGATCTTGGGCATCTCCTGAACCTGCAGGCTGGCATAGCCTTGAATCCAT
CCTTGGCCTGGGTCCACTTTAGCCATTGTTGTTTAAACGTATCTTCTTGAACCACCGGGC
AGGTAAGACTGGGCAGGCCTAGTTACCTGGATGCAGCTCCAAGCCAGTGACGAAATTGTT
CTAAATTCTGACACTTCATATGAGAACTGCATAGTGCAGTCTGATTATATTGAGAAACTG
AGGCTTAAAAAAACAAAGCTGCCCATTTAAAATAGCTTTGAAAAGGGCTAAGAACTCCGG
CCGCTCATTCCCTTTCATTTGACTTTCCAACCCCATCTCCAGACAAACAAAACAAAGCAC
CTTCCTCATCCAGCCTTTAGCCACTCAGCATCACCAACAGTAAGTTCAGTTTCCACAAAG
AAGAGGGGCAAGGATGAGGGGCGTTCTGGGGAGGGGAAGCTGCAACACGCAGGTGAGGCG
AACCTATCAGCACAGGGGTGTCTGAGCCAAAGGACAGGCGTGAAGAGAGAAGACAACACC
AGCGCTGTGCGGGGAGTGTGTCTGCTGCTGCCTGAGGGCGCTGTGTCATCACAGCACCCA
TGCTCATTCCTGCGGTGAGATCCCTGGGACACTGAGCAAATTCGCTAAGAAAGTGACGCA
CATGCGCTGCTTTTCTTTCTTTAAGAAATACGATCAGCCCAAACTCCACCACAAATAAAG
AGCACTCCCAAAACTGTCAACAGCGCTAGAAAGTAAGAAGACAGGACCTGGAATTAGCCC
AGCATTTGAATTCTATCACTTACTGGCTATGTGAGTTTTGGCAAATTATTTAACCTAGCC
TTGGGAACCCATCTGTTAAATACAGAAAGGGAGAAGGAATAACAGCATTTAATCACAGGG
TAGAAATGCACAGTCTGAAGCACACGCATACACAATGTTTAATCGATTCTATGTGGCGAA
CTCGGCCCATTCAAGTAAAACGAAGGGGCCAGGTCTGTAGCTTGATGGCACAAGCGCCTA
CCTGGCAAGCACAAGGTCCTGAGTTTGACTCAATACAAAAAGAATAAAGAGAGAAAAACA
ATGTATGAAATCAGAAGACTTGCAGCTTACAAATGTAAACCATAGGGGCTGGGGATTTAG
CTCAGCAGCATAGGCACCTGCCTTGTAAGCGCATGGTCGTGAGTTCGATCCCTGATACCG
ATTAGAAAAAAAAAAGTAAACCATTGATATCCATGTATTAATATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved