Cavia_porcellus Locus Mono:493:SNORA70
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:493:SNORA70
Cavia_porcellus
Mono:493:SNORA70
scaffold_248043
SNORA70
1001..1132
1622
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTGCTGGATACAGATGT
GTGCACACACTGTTACATATACTGACTGCTGATAATGCTGTATGATGCATTACTATGCTG
TATCTTAGCTGTGTTTGCAGTGTGTCCTCAGCTTGTATTTTAAAGTTATTATTAGCAGTG
CATCACGCTGAACTGGCAGCAGCCTCTGATCACGTCTCTTGATTGCATCAAGAGGCTCCA
TGGAACGACTGAACTTAGCATCTAGGTTTGCTTAAGTACACTCCACAGTGTTCCCACATG
GACAAAGTCCCCTAAGGATGCAGTTCTCAGACTGCAGTCCCATTGTTAAGCAACACTTAA
ACACTTTTATAGAACATTATTATTTTTTTTAATCGGTACCGGGGATTGAACTCATGACTG
CGCACTTGCAAGGCAGGCGCTTATGCCGCTGAGCTAAATCCCCAGCCCCTGAACATTATA
CTTTACACTACGCTCTTTCAAGTGCACATGGTATGTCAACCAAGACAGACTAAATGCTGA
GTGATAAAACATATCTGAATAAATTTAAAGTGACTGAAATCCTACAATTAATGAAGCCAA
TGGGTGCCCTGCTGTGGGTTCCCAGTGTGCAGTGGATGCAAACAGCAAGCTCCTTGATGG
AGTTCACAGCCTGCGGCTTGTATGGGCTGCCCTAAGAGGCCTTGCAGATCCTGCTTCAGG
GCTGGCATTTATGTATCTGACCTCCTACGGTCTCCAATCCAGGTTCCAGATGGCATGCAA
GGTGCCTTGGGGAAGCTCCAGAGTACAGTGGCAAGGGTTCACACTGGACAGGTCATCATG
CCCATCTCTATCAGGCTGCAGAATAAGGAACATGTGATTGAAGCCAAGTTCAAGTTCCCT
GGCCACCGGAAGATGCACATCTCCAAGAAGTGAAGTTTTATCAGACTCAATGCAGACGAA
TTTGAAGACATGGTGGCTGAGAAGCGCCTCATCCCTGATGGCTGTGGGGTGAACTACGTC
TGGAATCGCAGTCCCTTGGACAAGTGGTGGCCCCACACTCCTGAGACTTCTACTGTGCTA
ACTTTAACAAGTTCATCAGTGTCACCTCCGCTTCCCCAATAAAATGACTGAAATTGTACT
GTCTGTTTTGTAAATACTGTGAATTAAGTTAGAGATTAATAACATTACATAGGGAAATTC
CAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved