Cavia_porcellus Locus Mono:539:SNORA13
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:539:SNORA13
Cavia_porcellus
Mono:539:SNORA13
scaffold_89291
SNORA13
1001..1134
2116
CAGTGCTCAAATATCAATAGCATTTCTATACACTAACAACAAATTACGGAGAGGGAAAT
AAGAGAAGCCACAACATTCACACTAGTATCCAAAAACATGAAATACTTAGGAATTAATCT
CACAAAAGAAGTAAAAGATCTATACAGGGAAAAGTATAATATCCTGAAAAGAGAAATCGA
AGATAATCTTAGAAAATGGAAAGACATCCCTTGCTCATGGATAGGAAGAATAAATATTGC
CAAAATGGCCATTCTCCCAAAATTGTTATACAGATTCAATGCAATCCCAATGAAAATACC
ATCAACATACCTCCTAGACCTAGAGAAATAACTCTTAAAATTCATCTGGAACCAGAAGAT
ACCTAGAATAGCAAAGGCAATTCTAAGTAGCAAAGGCAAGGCAGTAGGCATCACAATCCC
TGACTTGAAGTTAATCTACAAAGCTACTGTAATAAAATCAACATGGTACTGGAATAAAAA
CAGACCTGAAGATCAATGCAATAGATTAGAAGATATAGCCATAACTACCAACACACTCAA
CCAACTTATCTTTGATAAAGGGGCCAAACTTGTTCACTGTAAGAACGACAGTCTCTTTAA
TAAATGGTGTTGAAAAATGTTTCTATATGCCGAAAACTAAAATTAGACCCATGCCTATCA
CCATATACTAAACTAAAATCTACATGGATCAAAGATCTGCATATTAAAACAGAAACACTT
GGGCTGGGGTTTAGCTCAGCGGCATAAGCACCTGCCTTGCAAGCAGGCGGTCATGAGTTC
AATCCCCGGTACTGATAAAAATGAAAAAAAAAAAAAAAAAAAAAAGCCAGAAACACTAAA
TCTGTTGGAAGACAAAGTAGGTAAACATCTTGAAGACACAGGGGTAGGTAGAGAATTCAT
GAACAAGAATCAAACCACACGGGAAATACTTTCCAGAAACAATAACTGGGATCACCTCTT
ATTAAAAAGTTTCTGCAAGTCAAAAGAAATCTCCAGTATCCAGCCTTTGTGTTGCTCATT
CACTTTTGAAAGCTAGTGAATGTGGTGTCCAAAAAAAGCATTGATAAAAGCTTTGCAGCT
TTTCCCTGCCCATGTATTTGGTATAGTTGGTGTAGGAGCTGCACAAGCAACAGTTTATAC
ATTTACGTTGCGTGTACAGGTAAATAAATCGGCCAGCGTGAGGTTTTTTCTTAACCAGTT
TTAACTAATTTTAAAAATAAAGAAAAGAAATCTACAGTAGAGTGAAAAGAAAACCCACAA
ACTGGGAAAAACAATCTTAGTGAACTGTCCCTCAGACAAAGGAATTCTGTGTAAAACCCC
CACACACTTTTAAAAAATAAGACCCCTGAAATTCAAAGACCCAGTCCAAAAATGGGCATC
TGAGATGAATACACAGTTCTCAGAAGAAGAAATAAAAATGGCAAATGAATACATGAAAAA
CTGTTCAAGATCATTTGTCATTAGAGAAATGCAAATTAAAACAACACTTGAGATTCCATC
TCACTCCAGAAACAATAGCCAGGATCAAGAAAACAACCAGTAACAAATGCTGGAGAGGCT
GTGGGGAAAAAGGAACCCTCCTGCACTGTTGGTGGGAATGCAGACTCATGCAACCACTGT
GGAGGTCAGTCTGGAGACTCCTCACAAAGCTGGAATTGGAGGTCGCATTTGACCCAGCTA
TTCCACTTCTGGGTATAACCCCAAAAGAACTAAAAACATACCACCGTGATATATATGGAT
CCATGTTTATAGCAGCACAATTTGTAATAGCCAGATCTTGGAAACAACCCATATGCCCAT
CAACTGAGGAATGGATAAAAAAGATGTGGTGGGGGGCTGGGGATTTAGCTCAGTGGCATA
AGCACCTGCCTTGCAAGCAGGCGGTTGTGAGTTCGATCCCCGGTACCAATAAAAAGTTAA
AAAAAAAAATGTGGTCTTTGTATATAGTGGCATACTATTCAGCTATAAAGAAAGACCACA
TTGAGGCTTTTATAGGTAAATGGATGTGACTTAAGACCCATACTTACAAGTGAAATAAAT
CAAACTCACATATGTAAATACCATATTGTCTCCCTAGTAAAAGAAACTGAAGGAGTAAAC
TAGAAAATCTTCAATTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved