Cavia_porcellus Locus Mono:533:SNORD83
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:533:SNORD83
Cavia_porcellus
Mono:533:SNORD83
scaffold_254188
SNORD83
1001..1075
2075
TTAAGATACCCATGTTAACTTCTGTTCAGTGGGGAATCTCAAGGATTTCTGCTCCTGTT
AACTAGAAAAGAATTTCTGGAAGATATGGTTTAATCAATCATTGTGTAAATTTATAAAGA
ATTTTTGATAATGCATGAGTCCAGATGGAATAGATATCCTTTCGTGAATAGTTATACAAG
ATGGAAGATTCTGAAAAGCATATGTATAAACAGTCTGTGCAAACTTAGTAAATAAATGAG
TTGATGTCTACATTCTGTGCATACATTTCAATCCAAGGAAACATTTCCATAATTAAGTTC
TCCATAACAAAAATACCCTCTGTAGTTCAGGTTATAAATGTGCATTTTTGGACTCTTAGT
GAACTGAGAACTGTTATTACTCTGCAAATGATATATACTTAATATCATCATAATTGTAGC
CATGTGAAAGGTTAAAATAGGGACATTCTATGATTTTCCATCTGGAAAATTTTACATTTG
GTGCAAACCAGAATGAGATGACTGGGCGATTCCTTAATTGTGGACAAAGAAATTTGTGTT
GGACCTTCTCTATTTGAAGACACTTTTGCTGTTGTTTAAACAAGTTTCATACCATGTGTG
ACTTTTTAAATGCTTCCCTACAGAGCTAAATTTTCACCTATGCCAAATCTAGTCTAGAAG
ACCAGGATTAAAATTTTATCTATAAACCCAGTTGAGGTGGCACATGGCTGTAATTCCAGC
ACTCTAGGAACCTGAAGCAGCAAGATCACGAATTTAAGCTCATCATTTGGGCAATTTGTG
ACTTTGGAAGACTTTGTATTGAACAAAAAAATAAAAAGCAGCTGGGGATACAGCTTAGAG
CAAAGGTCCTGAATTCAATTCCCAGTATGACAATTAAAAATTATCTCTAAATGTGTAATC
AATTTTGGATCCTTAGGTCCAATTATTAGTACTAATTTTATTAATTACTGACATTATTAG
TCAGTAAAAGTAAGGAAATGATGATAGAAAAGTAGAGGGGAGTCAAGTGATGTTTTCATT
TTGAGAAATGAGTCTTTTGTGCAGTGCTGACCTTAATCACTCATCCTTGACTGACAAAAA
AGATAAAGAAGGCCAAGAAAAGTAACTGATTGTTGCACCGGGCCATTAAGTCTGTAACTA
GTTTCACTTAACTTGGGCAAGGAGACTTCAATGAATTGTGACTTGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNACAATTATACTTTTTTAAATAAATACTGCCTTC
CAAATGGGTTGGAGAGAGGAAGCCTGAAGTCATGTGGAAAAATGATGCTGTACTCATCTT
GTGATCACTGTGCCTTTCTCTTGTGTGTCTTAAATTATTTTAATGTAAAGGATCAGATAT
TTGAACATTTCTAATTTGTCATGGAGGAATATACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved