Cavia_porcellus Locus Poly:21:SNORD99
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:21:SNORD99
Cavia_porcellus
Poly:21:SNORD99
GeneScaffold_6579
SNORA16, SNORD99
1001..1135, 2702..2781
3781
CCTGATGTGGATCTCCAACTCTATACCCATCCCCCCACCATGGCTCGCCACCGTCGACC
TGCTCTTGCCGGTTCTGTGTCCCAAGGTTGCGGTATGCGCGGCGCGCAACCCAGCCTATG
TACCTGGGAGGCCGCGCGCGCACCGAGGCGCGGCGGCGCGCCCTCGCTCCTAGGGGCCAG
CAACCCTGCGGGTGAGTGACGCTGGACCGTGTATTAAAAGGGTGAACGATCCCCAGTCCA
GCTTTCTGAGGGCTGCGGAGATGGGCTGTCCAGGGCCTGAAATGACCTAATGCGGGAAGG
AGTTCAGTCGGCCTGTGACATTAATTGGGTGATGCAGAGTCTATCTTGGTGGAAATAAAG
ACAAGCGTTTCAGAAGGCCAGATTTTAAGAGTCATTCTCTTACTCTGTGGCGCTGGTGAC
GAATCCCAGAGGCTGGATCACTCTAGGCGAGCACTCTGGCACGGAGCTAGACCTCAAGCC
CTCAAACGCTTCACTTTTAAAATTGGAGGCCGGGTGTGGTGGCGCATGCTTTGTAATCCC
AGCACCCGAGGAGCCGAGGCAAAGGACTGTTGTAAGTTCCAGGCCAGCCTGGGCTACAAG
GTGACCTTCAGGCTAACCTGAACTGCACAGCATGGCCGTCTCAAAAAAATAAATCAGTGA
ATAGGACAGTGTGGTAGCGCATTCTTGTAGCTTTTAAGAGGCCGAGGCAGGAGGATCACT
GCAAGTTTAAGGCCAGCCAGACTGTCCAAAAAAAAAAAAGGCTGAAGATAACATGGTAGA
GTGCTTGGCTACATGCCGGAGGCCCTGGGATAAAGCCGCACTACTGCAAGGAAGAAAAAA
AAGTGTGAAGGCAAATGGTAAACTATGGCCATCTTTGGGTGCCCCAGCAACAGGATGGCT
GTTGGTTCTGTTTTGGGGTCTCCAGTAGGTGGTTACATAGATTTAGGTAAGTCAGTGCCT
CAGCAGCCATTTGGGATTGAGGTCTTGATCCTCCATTATTCAGTGGCCCTTATCGAAGCT
GCAGCTGCTTGTATGTAGTTGCTGCAGTCAAAAAGGAGCCCAGAGTAAGAATTTTCCTTG
ACGGTCGCCGTTCTGTTTGCTGTAACCGATCTGCAGCATTTTGGGGAAAGACAGTTCCAC
TGTGCCTGCCACTTCTCAGGGATTGCGGGCAGCCTTCCTTCAAACTGGCTTGTTTCTTGT
AGAGGAGATTTTGCTGAGTTCGAGAACCGGTAGTAACGAGTCCTGAAATGATTAGTGGCA
CAGGATATGGCCATGCTTTGGGTCACAGCCCTGAAAAAGCGAAGGCACAGCATCAGGACC
AAGGCCAGGCAGGCCTTGGTGATGCTGAGGGCTTGAGGAAGGAAAAGAATTTTCCTGACA
GTTGTGCTTATTACAGCGGTGCCAGATTGAAGATCTCGGAGGTTACAGTGATGATACACC
ACAAAGCTCAAAATCTGGAGTCTCCAGGGTTCCTGGAAGTGACTGATACTGAGATGATTG
TCTCTGAAGCTGAGCCTAGAATAGGGTCTTGCTACACCATGCTGGGCTGACAGGTACACA
CTACCACATCTCACACCGACTGTGGGTCCTAGTTTGGAGAGATCATGAGAAAGACGACAC
AGGCTAAGAGGAACAGGTCATAAGTTCTTGTAAACATTTTTTTGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCAGTAAACCTGTTCTCACCTGT
TAATAATTTTTTGAGACAGGGTCTTTCTTCACCATGCTGGGCTGACAGGTACACACTACC
ACACCCCGCAACGGCTGTTAAGTTCCTAGTTCGGTGAGTAAATGAGATTTAGGCATATAT
AAAGGGTTGTAGCCTTTGCATTTGACCTGTGTGCCCATTGTTCATGACATGGCTTGGTGT
GTTGGGTTTGGTTACCATAAGGGTTAGCGGCTGCAAATTCTGCAGTGGCTGAACTCAGTT
TGATCTTTATGGAGTGGGAGGTGGCCTGGGGACAGAAATGAGTAGGTTAAGTGCTTCAGT
TCACTGGTCCAGGATGAAACCTAATCTGAGTGGACATCTGTGGATGAGAAATGCGGATAT
GGGACTGAGACCAGTGCTTAGGAAAATGTCTGAGTGGTGATAAATCAGCGCAGCGCTGAT
ACACAGGCCCACACTTTCTTTGCAGGAGAGACCAAGGGAAAGAAGACCAAGGCAAAGAAC
AGGCTGCAAGCTCTGTAAACGATTTTTTGCTATTGGTGAAAAAGCCTGTGACTGACTACA
GGTTGACCAATAAAGACTTTGGACCTGTCTTGAGTGGCAAATTTAATTATTCCTAGATTG
AAACTGATTTAATAAATCTTGTAACTTTTGTACTTTGTTTTGCTCTGATGTCATGGCTAT
TTTAGGTACTTCATTATAGACTAAAGCAGTAACACCTCCCAAGGAACCCCACTCTTTTCA
GTGAAAAGGAGGTGAGGTGCAATATTTTTTGCTGGTTTTAAAGAATTTAGGCTGGTCTTA
AACTCTCAAATAGTCCTACCTCAGCCTCCCAACTGCTACAGTTACAGTTTGGTACCACCA
CATCTAGTTTAGTGGCACTTACTGCAATCTGTATGTTACCCTAACATACCATTGCTCTTA
TGAGTGTTCAATAAAGCAGTCACGGGAGGACCTTACAGAAGGGCTTTTTGCAGGCTTGCA
CATAATTCAAGCTCCAAATCCTTAAGTGGGGAACAGGTCTGTCACTTTGTGGGCATAGAG
ACTTTGACCCAGTGTCAGGCAGGCATCATGCTGCTGACCTGTTAGGGTTGTCCTATACAT
TGACACAGTAGCCATCCATGAATGCCGAGTTTTGGGAAGTAGGACTGATCCACTGGCGAA
CCCGTAAACTTTGCCAGGAAGTATGAATAAGTAGGAAATAGCTGCTTAAATTGTCCAACA
GTTTCCATTCTAATGACTACCAGATGAAAACAGCAATGTTGTGGAAATAGTCATATCAGG
AAAGTTATTAAAACCTTATAAACCATTTCTGAAAAGGTAAAAATTTTCACATTTTTAAAA
AAGGCTCATCTTCCCTCAGTCCATGCTGCTTTGTCCTTTGTCTTAGCTACATCATGGCTG
GG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved