Cavia_porcellus Locus Mono:664:SNORA66
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:664:SNORA66
Cavia_porcellus
Mono:664:SNORA66
GeneScaffold_5036
SNORA66
1001..1139
2139
CACCACACCCTGCCTGTCACCAGGTCACTGGGCTGTAGCCAGCTTGGGTCTCTTTCTGG
TCCAGCCTGCTCACCCTCGCTTAACTACTCATCCCCACTAGTCAGTCAGCAACAGGCTCC
AGAGGGCCAGGGGTCCAGTGAGGCCCAGGAGCTGCCCCGTGGCCCTCACTGGCCCCAGCC
CTCAGGCTCAGACCCAAGGACAGCACTCAGGGGGCTGAGGAGGAAGGGCTGCTGCCTATG
GAGGCCAGTCCAGCACTCTGGCAAGCCCATCTCAAAATATACACAAAGTGCTATGATTTC
ACTCAACATGATGGTGCTATGCACCCCCAGAACCTCTAGGTGTGCAGTGGGCCCAGGGCT
GAGCCCAATCCTTGACTGGGCAGGTACTCAGCCAGCTGGTCTGAGTTTTTAGGCTGTACA
ACAGGAACATAAAAAATGGCAGACCTGACCGCTGACTGCAGCTCCAGTACTAACTGCAGG
GCTCAATGCTCCCAATCCTCATCACCAAGTCTCAGTTTACTCCCCTGTGAGGCAGGGACC
TCAGCGTGCAGTGAAGGCTCTGCCTGCTCTCAGCTCAGTCAGGTGACCTGCGCAATGAGC
TCAGCCCACTGGCCTCTGACCGCACCCCGACCCTGCTCTCCTGTGGAAAAGAATAGAAGC
ACTCCGAGGAGCCCCAGAAGAGTGCACATCGTGGTTCTGGGCACACAGCAAGGTGCATGA
AGTTCTGGACGGTGAAGAGCTGCACAAGCATACAGTGGACCCTGGCCACCAAACGTGACC
CACAGCCTTTGTGTGATAAGCACACACCCTACCAGGGAGCCATGCCTGCAGCCCTGATTT
TCAGTTTCAAAAAATGTTTTTCTCTACTAGGGATTGAACCCAGGGACTTTGCACTGAGCT
GCATCGTCAGCCATATTTTATTTTTTGAGAAGTCAGCTCATCTGGCATCCTCCAGAGTGA
CTTTTATCTTGCTTTTTTTCTCAGCCCAACCTAGCTCTGCAAAGCCAGTTTCTTCCTCAC
TTTTACTTTTTAAAATAAACTTTGCAGCTAAGGGAACCAGGTTTGCTAAAGTAATTGTGG
TGATAGGACTGTATTAGCCTCAGAAGCTACTGGGGTAGTTCATTCTATCCTCATATAGTA
AAAAAATAAAATAAAATAAAATAAAATAAAATAAAATAAACTTTGCTACCTTTAAAAAAA
AAAGTTGTTAATTTGCCCAGGCTGAGCTCAAACTTGCAATCCTTGCGCCTCAGCATCACT
GGGGGCTGGGCTCACAGGTGTGTGCCATCAAATCCCAGTCAGTCAAAGGCTGGTGAATGC
TATGTGAGAAAGTAACTGGTCACCTCCTGAGAACACTACCAACCCAGGGAGCAGGAGTCC
CAGGGTGCAAGCCCCTACACTGGTCCAGGGAGCCCCCCGAAGAGCTGCCCTTACTCCCAG
GGTGCCCGATGCAAGCAGTGTGCAGCTGCATCAGCCACGGTGAGGGACGAAATTCCAAAC
ACTGATCAAGAGGGCCAGGCTACCTGGAGAAGCCCGTCATGCTCAGGGCTGGGTGTGGCT
CAGAGGCTGAGCACCTGCCACTGGCATCCTCAGCCCTGGGTTCGAATCTCAGCACACACA
GAAAAGACACCTAAGATTTCTGTGTCCTGCAACCCCACTGTACTCTCCTGGCTTCCCTCC
TGCCAGGACGGACCCACAGTCCCCACCACCCCAGAGCCAAAGAGGTTCCCTCCCAAGAAG
CTTCGAGCTTACCTCTTCTCTGAGCTGTTCCTTCCTTTAGAAGTCTTTATCTCCACTGCC
CACTGGGTATAAGTAGAGACACTTTACAGGGACAGGTTTGAGGAGGGAGCACACTTCCTG
AGTGGCAGCATGGGTCACCTGTCCCACTGAGGTCCCCTCTGGCACCATACTTAGTGCCTT
CTCCAACCGGGCTCATGGAACGTGTGACTCCTCCGTTCTGGGAAACCCACGCCCATGCCC
TCAAAATGGGACAAACTTGCCACGTTGCTCAAGTGACAACACAGAACAGGCCAGGATAGC
TGTTCCTGGAGGGGCCCAAGAGGCACTGCAGTTCTAAGGTGGTCTCTAGGAAGGCGTCAG
GGAGCACCCCAATGGGACCGGGCTGGGGGTGTTCAAGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved