Cavia_porcellus Locus Mono:314:SNORD73
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:314:SNORD73
Cavia_porcellus
Mono:314:SNORD73
scaffold_242598
SNORD73
1001..1069
2069
ACTGCAATCCACACTGAGAATAAAGGCACTGAGACATATTCATAGTTACAAGCATCCAA
ACAATCTTAAGTCCAATATAGGTGAGGATTCACCCAGACTTAAAAGCCATGCCCCAGGGT
CTCACCCAGAATTTATTAATTCACGAAGAAAGGAGTGGCTTGAGGATGAGTGATGGGAAT
TACATAAGTCTGTGAAGTAGGCTTAGCCAGGAGACCAGAAAGCACTGTTGCGTTATGCAG
AGAGAAGGGTTTGCAGAAAGATCAGTCTGCATAACTCAATTGAAGTAGCATTTAAATGGC
ATTCCTGGAACTATGTGGCTCTACCATCCCACTGTACTCAACTATTTATAGAAGCACAAG
GTGAGGAAACAGAAAACTGTTGGCAGGCTTTAAAGATTACACATCAGTACTTTACCTAGC
CCTATTTACATTGTGTAGATCTAATTGAAGGGAGAAGGAAATAGCTTAGCCAGCTCTATA
CATATCAGCACCTGGAGCTAGGACCTGGTTTAAGTAATGTGGAGATAATTGTTCTGAATT
CAAGGAGATATGTTAAATGGTGTTGTAAAATTTGACTACCAGATATTTAAAAACAATCCT
CACATCACTAAATGATAACAAAAAATCAAGGCAATTATCTGACATATCATATAAATACTT
TCAAATTCAAACACAAAAATATTTGCCCTATGATTGCAGGTTCAAGCCCAGCCTGAGGAA
TTTAGCACACAATATAAGGGAGGAAAAGAGGCTTGCCCCCCCATCAGACTAACTAATCTT
GTACAAGAAATTTCAAGGCAGTAAAATATTGAGGTTGTGGCACGGTTGATGCTGGGGATT
TTACACGGATCTATGTTGAGAATCAAGATCAAAGAGCTCAGCAGGATGGTTTGAAATGTG
CATTGGGCCAGAAAGAAAGATCTAGTGAAGCTGTGGACTGCAAAGATGGAGCAGAGGAGA
TCTTAATTGCTGAGAAGTAACAGGAGAATAAAAAGTGTCACTATAAGTGATGAAAAAATG
TTTTGGTCCCAGTTGATGTCCACTGATAACTGTTACATTTTTCTGATGTTAAAAAAAGGT
GTCACAAGACCATCCCAAGAAGCAGAAAGTTCTTTACCCTTTGCAGCTTCCAAATTGCAA
AGTGAAATTTAGAAATTTGCTTTGAGAAGAAAGCCACATAGTGCCATATTCCAGAATGGT
GGCATCTTCACTGTGTTCCAGAATGGCAGCAGAATAGAGAATTTGCTCCTCAGAATTGGA
TTTAGAGTGCTCAGTGCTCAGGCACTTGACTCTGACAGTAAAGACAAAGAAAAATCCAGC
TCCAGCTGGCAGCTCACATTGGCCACATCCATGTGGTGCTGGTTTTAGGTGCATGAAGAA
TGCAAGAGTTATGGGGTTAAGAAGGCTTCTACCCTGATATCAGAAGGCTTGGGAGCCAGG
CAGGCTGGTCCTGAGATGCAGTGTATGAAGCTGTGAGGGTGAAGCTGAAGGTGTACTGGA
GACCAGAAATTTCTCCAGAAGTATGGAGAAGCCAGGAACGTGGATCATCTAAAGAAAACT
GCAAGGAGGGAAGAAAGTAGGCCTAAGAGAGAAGCCATGAGTGCTACAACCACTGGGAGT
GCCATAGGCATGGAGCAATACAAGCCCTTTAAAGCTCAGACCTTAATACAGATTGCCTCA
GATGCTGCACTTGGAACTACTGGACTTAATGTTTGCCCTGCTGGGTTTTAGGCTTGCTTT
ATTTCAATTCCTTTGTATCCCCTACTTGTAACTTTTGGAATGGAAATGTTTATCTCGCGC
CTTTGAATGTTGGGAGTGTTTAACTTTTTTCATTTGTATAGTGCTTAGTGCTAAGAGTTC
ACCTTATGTCATGCAGTAAGGTGACTTGGACTTGGGACTTGGACTTCTCAGCAATGCTGA
AACTGTTAGAACTTGGGCAACTCTTAGAGATGGACTAAATGCCTTTTGCATAAAGGGATG
TGCATGAGTCTTTTGGTGGGCCAGGGGAAGGATATTATGGTTTGTGACTGGATGTCTCCT
AAAGTCTCATGTAGTAATGGGGGCAGGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved