Cavia_porcellus Locus Poly:9:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:9:SNORA2
Cavia_porcellus
Poly:9:SNORA2
scaffold_290484
SNORA2, SNORA2
1001..1138, 1805..1927
2927
TGCTGGGACTCTGCCAGTCAAAGCTCTCTTCTTCATGCCTCTTATCACAGGGTCCTGAT
GGCCATGAGTGTCTAAGTGTCTCAGAAGCTGTTTTTTATTTTCTCTGGCTTGTGTTTCTT
TTCACTTAATGGATTTATGTTCTTTGCCTGTCATACTCTAAGTGTTCCTCTGGACAGAGT
TTGCTTCTGGCAGGAAGGACAAAGGAGAATATCTGGCTCAGGGGTTCAGACGGCAGCTCT
GCAGCAAATGTGGACTGAGGTCCACTGAGCCCATAGTGACCGAGAAGTCTAGCTGCAAAT
CTTTATGTTTGTCACAGAGAAACACTAAATCTGTGCAGTGCGGCTGCAGTTACTCTGCAG
TGTAGTTTAACTGACTTATCTTGTTAGGAATCTGCATATGCATATAGTGTTAAATCTTGC
TGCCAGCTCAAGAGTGTTATGACTAAAGAAAAGACTTGGCTAACATACTCTAGTGGTTTT
AGATACTTTTCCTTTGTTAGTCAATAAACCAGCTTTTGGGGGGGGGATGGGTTGTGAAAA
AGTTCACCCATACATGGCAAAGTTTCTCAGTGTCAAATGTCTGTCACAAATTTTGCTTGT
GGCCATCTCCAAAGCCTACAATTTAAAAAAACTCAGCAATTATCTCAACCAAAGTGCTAT
TGAGTGCACTTTCCAGTGGTTGGTCCTCAGGCTTCTTTCCCAACAATGTTTTCCTCATGC
AAAAAGCCCAAAGGAGCTTGTGCGTGGCTCCTGAAGCTGAGAAGTCCACTCCATGGAAAA
TTTGCATGCTGTAATTGAGTTGCTGGGAATATCTAAGACACAATTCTTCAGGCTTGTGAC
GATCTCGATTCCCTCAAACTGACAGTGGAAACGGCAACCAACTCCTCTGTTATCTTATAA
CCTGCTTGTAAGATTGATCCTTCATAATTCAGTTCGAATTATCTGGGTTTTAGGAGGTTG
TGGCTGGTCAACTTCAGCCTTCTCCTTAAAACTTCTACAGACTGGCCCTGAATCAAGGCC
CGCAGCTTCCTGATGCTGTTGGTTTCAAGCAGGAGCCTAAAGAGATGTCTTTCTATGGTC
TGTTGGGCCTTTTCAGAACTTGGGCAGTGAAATGGTCAATTCATTAGAAAGAAACNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTACCCTAGAGAAAATAAAGCAT
GAAAACAACAATTCAGGGTAGGGATATTTCAGTGAGACAATATTATGAAAAATGAAAATT
TTCAGATATTTAAAAGGGAAAAACTGATACAATATTTGATTGGTTTAACAATAGATTAAG
ACAGTAGACAGAAGTTTGACTGAACTTTAAGATGCCTGAAAAGAAAATTTTCAGTCATGA
ATGGGGATATGTATCTCAGTGGCAGAGTGCTTGACTACTGTATGAAAGATGCTGGGTCTT
AAAGAAGAAAAGTTTCAAACTATAGAAAAGAGTAAAGCCAGATATGGTGGGCCATCTGTG
CGACACCAGCACACTGGGAGACTGAGGCAGGAGGATCACAAGTAGTGCAAGGCCAGTTTG
AACCATTTAGAGACTTAGTGAGACTCAATCTCAAAATAAACAATAAAAAGTAGTTCTGGA
GATGTAACTCAGTGTGAAAGCCCTGGTTTGATCCCCTAAATAACACCACACCTTCCACAA
AAAATATTAAAATGATGAAGAGAGGTCCAGTGACATATGAATTGTGATATGTCAAATGGA
AATGCCTCGCCCTGAATCAAGGCCAGCAGCTTGCTGATGCAGGAGCCTAAAGAGATGTCT
TTCTATGGTAAGTTGGCCATTTCAGAACTTGGGCAGTGAAATGGTCAATTCATTAGAAAG
AAACAGCTTGAAACAACCCCTTCCCACTCACCCCCGTGAGTGCTGTGAGGGTGGCAGGCT
GTGGTGGCCCAGGACAGGAGCCACCAGTGTCCACTAGGACCCGTGCTAAGCTGGGACCTG
GAACACCAAGAAACCAAGCAACCCTTCCCCCACACCCCACACCGTGAATGGCTGTGGGCA
TGGCAGGCTCTGGCAGCCCAGGACAGGAGCCACCGCTGTTTACTGGGACTTGCACCATGC
CAGGACCTGGAGCACCAGGAAACCAAGCAATCCCTCCCCTCCATAGTGAGCAGCTGTGAG
TGTGGCAGGCTCCAGTGGCCCAGGACAGGAGCCACCAGCATTTACTGCGACTTGGGCCAT
GCTAGGACCTGGAGCGCCAGGAAACCAAGCAGCCCCTCCCCGCTTGCCTGTTTTGTTTTG
TTGAGCTTCAGTATACATAAAGGTATAGACAGCTATTTTAGGAGAATGGCAGACTCTATG
ACAGCCATTAGTGACTCCCTTATTGTCTGGTTTTGAAGACCTAAAACGCCTTCCTCATTC
AGTTCAGATCAGTTTTAGACTATGTTGTTTTGTACGAATTCTCTGTATGCAAAGACATAG
GCAACTGTTTGGAAGAAAACAAGACACAATATGATACACAGTGAAGATCTCAGGTCATCT
AGCTTTGAAATTTTTATCTCTTACATTCCTGTTTTTATGTCCTATTTTGCTGTTTTGTTG
TGTTTAATTTTATCCCCTTTAAAATAAAATTAAAAAAAGAAAAAAACTTCTACAGAATAT
TTCATTTTTACCATTCATTTGGATTTGGGACAAGCATTTCCAAATATTATGCAGTATTGA
ATTGTTTAGTGTGGAAATATCTTGTGACCCTAGTTCTATGGGGCTTTGGTTTAAATTGGA
GAGAAAAAACTTTCTTGTGCTTCCTTAGATCTGTAGACACTGCTACTTTTGAATGAATGA
ACAAAGAGATACAGTTAGCATTCCTTTGAGATGCTTTGAATACTTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved