Cavia_porcellus Locus Poly:2:SNORD116
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:2:SNORD116
Cavia_porcellus
Poly:2:SNORD116
scaffold_254520
SNORD116, SNORD116
1001..1091, 3264..3357
4357
TGGAAGTCCACACCAGAAGCGTACTTGTGGTGAGTGAGCCCAGGACCTGGAAAGTGATT
TTTTGATCTCTCCTTGTGGTCGGCACGCATGTGGTACCTCCTTGTTACCACCCAGGTCCC
CTGGAGGCATCCTGATGAGGCACCCCTGCTTCAATAGAAGGGGGTTGTATGCATTTGGTG
ACATGTTGGACCCCAGCTTCTGTCCTCAGACACATGTCTGTGTTCGTGGCATGGCATTCT
CTGTCTGCCTTCCATGTTGGGTTTGCTTTTCCAGGAAGATGAAAAAGGGCTCCAGTCTCC
CACTATACCCCATCCTATCTGATCCCTTCACCAGTCCTAAAATGCAGCCTTTGAAGGGGA
GGTGGCCTCTGTTCACCGTGTTCAGGTTGTTGGAGATGGCGTGTTGTGGATTGTTCTGGC
GAGGGAAGGGGCCAGGCCAGGTTGCAGGGTGCAGTGATGGCCAGGAAGGGCCTGAGGCAA
TCAGTCCCCTGTGACTTAGCCAGAGGCCAGAGAAACAGACCTGCAAGCTGGCACCATGCC
TGCCCTGTGCACTCTTACACTCTAAGCTGTCACGAGACAAGGAGACGGTAGAGCTGGAGT
GAAGGGCAGGGTGGGCTGGATTCATGATGCCTTTCTCTGCCTCATGCATGATGTTTCTGT
CTCTACTACTTAGGGGAGTTCTCGTGGGAGGTCAGCCTGCAGCTGCATGTGGTGGTGGAT
TCCTTGCTCCAGAGGTGCCTTGGAGCTGTGACAAGGACTGTGTCATGACCTCTATGCCTG
AATATAGGTGGCCGAGGATGGTAAGTATTTCCTCCTGCAAGGAACAGACACTGTTCTGAG
GACCTTGAACCTGCACTGGGCTGGAAATGTTCTGGGAGGGGTCACAGCTTGCAGAGACTA
TGTATTCCTGGAACATGGCCGTTTGGCCTGTGGTCTTGCAAGGCCTTCGAGGTTTTCTAG
TTTGATCAACAAACATGGCTGTGGCATCTTTGAGTGTGCTCGGATCGATGATGACACCCC
AATTACATTCCTTGGAGCTGAACAAAATGAGTGAAAACTCCTAAACCGTCATTCTCATCA
TGACTGAGGTCCAGCACGTGGCCGCACACAGGGAAGGCAGGAGCAGGCCTCCACTTGAGA
TGCACACACAGCCTTCTCACTCAGGGGTTCGTCCCTGTCCAGTCCCCGCCTCAGGCCCTC
AGGACATGTCCTCCCTGGGGTGGCCCGGCTAGGCGAGGTTCGGGTTTCTGTGATCCCTGA
GCTCTGGTTGGCATTCTGGAGCAGAAGGGTGCTGAAGGCTCGGTGACTTTCCCCCAGGCC
TCGGGGTGGGTGGCGCAGTTAGTGCCTCTGATCCGCAGGGGCTGGCATCCTCACTGTGCT
CTGGGCCGATGCTCATTGTTCTGGGATCGGGCGAGGTCCCCCTGGAGCAGAAGGTGGTTC
TGTCTGAGTGAGCTGACGTGCACAGGGGCCAGGCGGATGTGGAACATGAAGAGGTCACTC
GATGCAGAGCGCATCTCTCAGTGCCAGGTTTGGGAGGAATCCATTCCTTTCTGGGCTCAC
TGTGGGACCGCCGGTGGCATGGAGATGTCCCTGATGTTGGGGAATGGCAGGAAGCCTCAC
ATCAGCCCTTTTGGCCAGGGAATTGCAGATCTGGTGTCGTGAAAGAGAATGTGGAGCTGC
ACGTCACACACTTAACTGAGTTGTTACCCAATCCCTGCTTCCCTGTAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGAGCCTGTTCGTTAGCAGCTGTGTGCTTGCTGCTGTGTGTGAGTCC
CGGTCTCAGAGTGCAGCCAGGCTAGGAGAGGTCAAGAGAACCCTCCCCAGCATCTGAGCT
GCAGGCCCCAAACATACACACAGTCATGTGTGGATGCGTTCACCCAGAGCACACAGGGAA
GGAAACACTGGTACTATGGGAAAATGCCCGTGGTGACCTGTGAGGAGGCGTGCAGGCCAG
AGTGGCATGAAATCGGCGATGGGATGCTTTTCCTTGTCCTCAGGCCCGCCCTCTCCCATT
TCCACTACGCAGAGACAGTTGCCCTGTTGGGCGAGCCTCAGCTGGGTGTTCCTGTTTCCT
GTGACCTGGAGGAGCCGTGGAGCACCGCGAGCCTGTGTCTTCCCCACCAGCCTGTGGGCA
GCTGAGCACAGTAAGGATTTCCTGCCTGCAGCTGGAAACATCCTTGTAAATAGCTTGTGG
AGCCCTCAGGAGCTTTGTCCTTGCAGGTCTGACCATGGAGTTTCAGTCCTCGAGTTGATG
ATGCTCCTGGGGCACAGTGGGGGGACCCTGGGTCTTGTGTGCCCTGTGGTTTGAGAAGTA
CCTGAGGCATCTCTGCATGTGCTCGGATCGATGATGATGCCCCAAAAAACATTCCTTGGA
AAAGCTGAACAAAATGAGTGAGAGCTCTAAACCGTCGCTCTCATCGTGCCTGAGGTCCAG
CACACTGCCTCGCACGGGGACCGCAGGAGCAGGGTCAACATCTACATGCTGTGTCCCTCA
ACCCTGCAGGCGCTCACCATGGGTCAGCTTGTTATCGTCTGGGACCCACGAAACACACAC
TCAGTGGGGCGGGCCTACCTAGGTGATCTGGGTTAATGGGTCCCAGCTTGCCTGTTGTTC
GTATACACAAGGGATAGGCCAGGCTGAGTTCTCCAAGCCTTCTTGGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved