Cavia_porcellus Locus Mono:735:SNORD59
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:735:SNORD59
Cavia_porcellus
Mono:735:SNORD59
GeneScaffold_7491
SNORD59
1001..1070
2070
CTGAACTACTTTGGCAATGTTTTCCCTAGAAACTGCTTTTGAACTGTGTGAAAAATTTA
AACTCCCCACTTGAGAGATTCCAGCTCACCCCAGAAAGAATGGCTACTATCAAGAAAGCA
ACCAGGGGGCTGGGGATTTAGCTCAGCGGCATAAGCACCTGCCTTGCAAGCAGGCAGTTG
TGAGTTTGATCCCTGGTACTGATAAAAATGCAAAAGACCAAAAAAAAAAAAAAAAAAAGA
AACCAACCAATAACAGATGCTGGCCAGGGGTTTGAAAAAAAGGAACCCCTCTCCACTTGG
TGGCAGTGTAGACTGATGCAACCACTGTGAAAATCAGTGTGGAGATTAAATACTAGGACT
AGAGGCCCATTAGACCCAGCTATTCTCCTCTGGGCCTCTTCCCAAAGTAAGTTAAAAACA
TCATCCCACAGTGATATATGTGCGCCCATGTTTATAACAGCACAATTTGTAATAGCCAGG
TTTTGAAAATAACTTAAGTGTCCATCGACAGAGGAATAGATAAAAAAAAAATGATATGGT
ATTTTATACAGTGGAGTACTACTCTGTCATAAAGAAGGATAAACTGGAGACTTTTATAGG
AAAATGGATGCAACTCGAGACCATACTTTTTAATGTGAGGACTTTGCGGGGGGGGGGGGG
GGGACCATACTTACAAGTGAAATAAATCAGACACACATGTGTAAATATTGTATTGTCTCA
ATAGTGTGAGAAGGTGAAAGAAATAACATATAATAAGATAGTTAAGGTAATTATACTACT
GGTTTCTCTGAGTTCACTGAAGAGAAAATTTGTTCTGGTTCTGTTTAATTGAATGCAGAT
GACCTGTGCTCTGGGTGAATGATTTGGGGAAGACAGTATGCAATTTATATGCCACTGTTG
CCTCTTGATTGACATATTTTCAAATTTTGGATTTTGTTTTGTTTTCTTTTCCCTTTTTCT
CTTGTTGAAATAAAACGGATTTGGAAAAAATAAAAACTCTGCCTCCCTGATGAAGTTTCT
GACTTTTCGATCTTCTGAGTTTGCTGAAGCCAGATGCCATGCCAGAGAAGAAAAAAAAGA
AGAAAAAAATCTTTGACTCCAGGTGTGGGCACTCACCCTGTGGCACGGGAGCTTTCGTCC
AAGTCCTCTATGCTGGACATGCTGAATGGAGAGAAAGAGGCGGAAGGAAGCTCCTCCTGC
ACCGGCTTTCTGGACTGCAGGGTGGGAGCACCCACATCTCTCAGGGCCCGAGGAAGGGGC
TGGAGGGACGCCCCCTCCTCCCAGAGCCTGGAAGGCCAAGGCAGACCAGGAGTCATGGCA
GGACCACAGTCACGGGCAGGGCCATGAAGTGGCACAGGCCTGTAATCGCGTCACCCAGCA
GGGGTTCCAGGAGGTTCCCGAGGTGGAAGAAGGAAGCCTGAGTCACTCCGTCACAGCAAA
GGAATTTCCGGACATAAAGCGGCTTACTGGGGAGAATTCCTCAGTCCGCAGACGGGACAG
TCAGGCCGCCTGTAGTTCCGCGGGTGTTTGTAGGAGACTCGGGGTGGAAATCCGCACACC
CTATCCCTCTACAGGGACTCCGGTAAGGGGTGAAGGCGGGGTTCCCTCCCCAGCGGGAAG
GGCGTAGGCCGGATCTCGGGACAGCCTGGAGTCCTGGTAAGGGGAAGCCGCCCGCCCCGG
GGGGCTGCCTATTCCCTGGGGAAGGGCCAATGCGCAGGCAAAGGCAGGCCGGGGTTTAAT
GAGTCTCCCAGAATTTTAGTAATTTTTTTAAGGGCTTTGTATCGCAAAGCGCAGTTTTTA
TTAAAAGTCCAATTTTTTTTTTTTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGCCTGCGTCCCGCCCCCATCTGCCAGGAAAAGAAAAGGGTTTATT
GTTGGAAATGATGTTAAAGATACGTGGATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved