Cavia_porcellus Locus Mono:SNORA31
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:SNORA31
Cavia_porcellus
Mono:SNORA31
scaffold_6
SNORA31
1001..1126
2126
ATGTTCTGACACTTGGTTGTGTTATGGTTTGCTCTGAGATGATTCATGTTTTTATATAA
TGGTCTGATTCTGAGTATTTGTTTCTCAAGTTCTTTATTGGTGCAAACATGAATCCAGAT
GGCATGGTTGCTCTCCTGGACTACCGTGAGGATGGTGTGACCCCATTTATGATTTTCTTC
AAGGATGGCTTAGAAATGGAAAAATGTGTAAGTATCAGAAAGTGATTTGAAATAAGTGAT
GTAAATATGGAGGTATTTTAAGTATAGGTGTTTTGTGCTATTAGGGTGGTTACTTGGTAG
TTTTAAAACATGGCATCTAGGTGTTTGGGGGGGTTGTCTTTGGCTTTTTGTTTCCTCTGT
GGAGGGTCTGTAAATAGGTTTGTCATTCACATGTAGGAGGCTTACAGTATGAAAAACCTG
TAGAAAACTGAATGGTTTGTAAATACTGGAGGCCAGAGATTTAGCTCTCTGGCATAAACA
CTTGCCTGGCAAGTGCAAGGTCAAGAGTTTGATCCCTGGTACAAAAAAAAAATACCGAAC
TGGAAATCAGAAATAGCACTCTCCTCCCCCTTTTGGCCTGACATTCATGATTCTTTGAGT
ATCAGGGTTTTTTTTTTTTTTTTTTTAAGCTTAGATTTACTGGTAATTGGCAGCTGATAA
TTGAAAGCTTTAGGACATTTAGCTGCTAGTAAATAGAGCTGACTACTGATGGACTTTGTG
TCAATAAAAGGAAATACATTCAATAAAAGTGAATGTCGGGTTGCTGCCATGCAGACTGAA
AAAAAGTACTCGTTCATCTTAGCCTTAGAGCCAACTATTTTAAGAGAAAAAGCTTGTTAA
GGATACATTGAACAAAATGAGGGTCAACAAATGGGCAAAAATTGGCACAAGATAACGTGC
CCAAAGTGGTTAGTCAACCACTACGTGAAGTTTTTTGGTAGGACCTTAATGCAGGGTAAG
ACTTGTAGAAAATACTCTACCTCTGATTTGGTAAGGATGTCCTGCATCCACTGATAGACC
TTGAACAATTTGTTGTTCTTACGGTTTGCACGAGGATGCTAAAGGAAACATCCCTGCGCT
TTCTGTCTGTCTTTATGGCAGCCCAGATTGAATTGGGGAGTACACCCGTATGGCATAGAA
ATTTAGTGCTGTTAATTGAGAAAAATGTTAATGCAGTCTTTCTTGTTTTTACAGTAATGG
ATTCGGTGGTTACTTTGGATGTATCACTTGTCATAACTGGCTGCTGCTTGTCATCCACAC
AACACCAGGATTTTAAACAAATGGGACTGATGTCATCTTGAGTGCTTCATTTATTTTGAC
CGTGATTTATTTGGAGTGGAGGCATTATTTTTTAGGGAAAAAACACTTGTCATGTAGGTT
GTCTAAAAATAAAGTGCATTTAAACTCATTTGAGAGAATGCCTCTTAGTTTAATACATGT
ATAAACTAAGTCCATTGTAGTGTTTGTGGAGAAGATAGACCACTGCTAAAAAGCATAAGA
CTGTCTTCAGATAACTTCTGCAGTGGAAACTACTCCTGAGACTGGAACCTAAGAAAAGAA
TCAAAGTATTAATTCTGAATTTCAGTGAAGGGGAAAAAGGACTTTCATAGCAGTGCCAAC
ATTTGAAGTGGAGCCTTATATATTTCATCACCTACAATGGAAGTAGTTAACCATGGACGA
GATTACCAAAAGAATAAAAAGACTTAACTCAGTTGGAAGTAAAGTATTGTCTGAGTTTAT
TTAATATAAATCAAGTAAAACCAGGTCTGGAATGGATGTCAGACCCTGGTTAATCAGAAT
GGGGGTTGGTAAACAGGCCTGTCTGCTGCCTCTGCAACAAAGGTGGTTATAGTTTAAAAT
GGCTGGGGAAGGGGATCAGAAGAGTGCTTGTGACATGCAATTTGAATTTGTTCAGTTTGT
GGGAACATTACCATGTTCATTATAATTTTACTGACTTTTTGCATTGCAAGAATGTGTGAC
AGGCCTACAAATCCTAAAACAACCTTGGAACCTTTTGTGCAGATTATCCCTGCTTTAAAA
GATAAAGATGCAATGTAGGGTAGCTGTTAGAAGAAAAAAGTTTCATGTTATCAAAAAAGG
CCATGCAAGTACTATGCACTTGGCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved