Cavia_porcellus Locus Mono:224:SNORA74
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:224:SNORA74
Cavia_porcellus
Mono:224:SNORA74
scaffold_235987
SNORA74
1001..1159
2159
TCAAAGCCAAGTCCAGGCCTGTCATGATGGCACATTCCTATAATCACAACACTCGGGAG
ACTGAGCGGGAGGATTGCTGGGAGTTCAAGGCCAGTTTGAACTGCATAGCAAGACCCCAA
ATAGGGCAGGGAGTTTAGCTCAGTGGCATAAGCACCTGCCTTACAAGAGCGTGGCAGTTT
TGATCCCCAGTACAAGAGGGGGGGGGGGAATAAATACTCATTAAGCTAACTGTGGTGGCG
CATGCCTGTAATCCTAGCACTCAAGAAGCTGAGGTAGGAGGCTCCTTGCAAGGTCAAGAC
CAGCCTGGGCTACAAAATGAACTCAAGGCCAGCCTGAACTGCATACAGAGACTCTGTCTC
AAAAGGGAAAAAAAAGACCCCAGAAAAAGCCAAGTCCAAACTGCAACAGCAAGAGAATTT
TTAATGACCTATCAGTATACAGCACTCCCACAAGACTGGCACTGACCTCTAATAACTTTA
CTCTGGTGCCTTTTTTCCAACAGGATGCCCACACATCCTGCTATGCTTGTAGTAGCCATG
AGAAACTATTCTTTTTTTCTCATAACAGAAAGGCAGGGATGTCAGATACCATCCATCGCT
ATAGGGGCGTGAAGATAATAGGAAGACAGACTGAGAACAAGATAAACAAGCACCTGCCCC
ATACACCTTCACCTGAAAACTCAGATACTGCCAAAACCCACAAGGCTCCCTCTCCCAAAC
CTAGCTTCAAAATTTTTCACTCCTCCCCGCCAGACTCCCTCTACCATAAAACTTTCCCAC
CCAGTGCTCAGCACCAGTGACCTTATCGCCCTTGGCCTAACTCTGTCAGTTGAAACAAAC
TGGCTCCTGCTTCAGCCTCACTAACTCCTGGGCTCAGTTACNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCTAGTCTGATGCCATGATGTGTTACACTGT
AGGAGAGCAGCGCTGTCTCATCAAGGTTGGTGTCACAAGCTGTTTTAGTGTGTGGCCCAG
TGCCTTCGGGCAGCGTTTTGTACTTCTGAGAGTGGACTGGCTCCTGCTGTGGAGTTGATC
CTAGTCTGGGTACAAACATTTTGTATTAGAAAAGGACTTCTGAGAGCTAGGGGTCTAGTT
CAGTGGCAGAGTGCTTACCTTGAGTAAACACAAAGCCTTGAGTTAATCTTTAGTACCTTG
GGGACACTTGTAGGAGCAGCCTATGACCCTTTATCTCCTTTAACCCTAGATACCTTCATG
TGAATGAGGACCCTGCCTCCATTGGGACTTCAGATGTCTGACAGCCCTGTGTCACACTGA
GCAATGTATGTAGTCCTTTTGTCATGTAGGTTCTAATTCTATTATATTAATATATGTGTT
GCTGAATAAGTACCCCCGTTATATTATTGCAGCTTAGATTACAGAGAATCCAAGTTCCAG
AAAAAAATGTTCAGAATCTAAAGTCCAGCTGTCATTTCCCAGAGCTTGTATACTTGTGCA
CTATATGTATGACTAAGTTGATACAAATTAAATCAGTTTTTTAATCCCAGTGTCTGGCTG
TCTAGTGACTACTATATAAGACAGCTCAGACATATAGCCAATATAGATCATTTATTATGT
GTCGGCCTAGAGTGGAGGTAGGATATACTTCATATATATAATGAGCAAGATAGAAATATT
AGATTTATGCAGCCGTGTAGTATTTGCAATTAATTTGCAGGTGAAACATGAAAGACAGCT
GGGTATGGTGGCTCACTCCTGTGACCCCAGCACTGTGGGAGGCTAAGGCAAGAGAAAAGC
AAATTCAAACCCAGCAGGGACAAATTAGCAAGACCCTGTCTCAAAAAATTAAAAAGGGCT
AAAGATATAGTGCATGTATGTTGCAATAAAACGTTTAAATTTCTTTTTTTTTTTTTTTTT
TTTTTTTTTGGTCTTTTTCCTTTTTATGGTACCGAGGATCGAACTGGAGACTGCCTGCTT
GCGAGGCAGGCACTTATGCCGCTGAGCTAAATCCCCAGCCCCTGATCCCAGCACTCTTGA
GGCTGGATGATCACTATGACCTGAAGGCCAGCCAGAACTGCACAGTGACACTGTCTCAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved