Cavia_porcellus Locus Mono:738:SNORD21
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:738:SNORD21
Cavia_porcellus
Mono:738:SNORD21
GeneScaffold_3495
SNORD21
1001..1097
2097
TGGCTTTGCCAGTTCAGCTGCTTCCTAACTAATTCAGCCATAACCTGAGGCTATTGTTG
AGTGACTTTTCCTCATCATTTCCCTCTAAACTCCAACCCCACCTCTGCCAAGCCTCTTTT
CTGTAGGCCAAGTGGCTGCATTTCAACCAATACCATCTCTGGCAGACGGCTGCCCATCTT
GGGAGACAGCGCACTCCATCAAGCTAACGAGCAGGGCCTCTCTGGCCAAGCTGCAGCACA
GCAAGCAGCCTGTCAAACTCTAGGACCTCCTATCTGAACAGGCTGGAGTAGAGACAGAAT
CCCCTCCCCAGGACGCAGCTGCTCTGCTGCTTTTAACATGCAAATGCAGGCTTCCTAGTA
GGGCAGGGTGAGGCAGAGCCCTCCCAAAGAATCTTGATAGGCAAGCTCTCTGTTGGACAG
TACTTAGCACCAAGCTGTTGCTTGGTAAGTATCAACTGACAGTCCTTATTGCCCTGAAGA
GAGTTATAAAATGTTCCTCAGTTGTGTGGCTGATTAGAATTTTGAGATGGACTCTACTCC
CTAGAAAACTTGTAAAGGATGCACTGAGTTACTCCTATTTATACCAACAGAAAACTGGAC
AGAACATGCTCACCAGCCTTGCCCTGTTTTGTTCTGGCAAACCAGAGAGGCAGCCAATTT
ATAAAACTAGTTATTTATCATAACCAATGGTTCCATTTTGGGGCTGGAGAGCTACTCTGG
CTTTTACTTTCTCTGCCTTCCCATCAAGGCCCATCACTTTACTAATTATGACTCCCCTCA
AAAGGACAGAGAATAAATAAGTGGTGATAAAACAAAGATATTTTATACTATACTAATTAT
AAGCAGATCTGGAGGGAAAAAAAGCAAAGGTGTGGGATGGGAGGGACATCACAAGATTTG
TTCAGAAATAGCTTCATTGGCTAATTTATAGGAGACCTTTGATTTATAGATACCAAACAC
ATACAGGTTTTTCTCTCTTTATGGTCACATTTAAAAGAATGATTGAATGATGATACCCTA
CTAACTTGGCAGTCAGTAATTGGTCCTTTGGTTGCATATGATGTAGTAATTGTTACAAAA
GATGAGAGGGATAGGAAAAAAAGAAAAGGAATCGTATTTACAATAGCGACCTGGTGGTAT
CCAAAAAAGGGACAGAGCAAACCAAATACTTCTCAGAAATATGCTGGTGGGGTCTAACAC
CATCAAAGTATGCTAGTGTAAGTGGGGACCTGCAGCATAGGCCTCTGACCTGGGAATATC
TATAAAATCATTAGACAAACCACACTGAAAGAAGCATAGTTGGAGACAAATTCATTCTGA
GAATGTTTTGTCAGCAAGTTCTGATAGCAAGAACATCAACAAGGAATGGTGGTGATGAAA
GAGGTAGGCAGTGGTCTCAGCTGGATCCTGGGATCCCAGGTGGGGCGTGGGGCTGTTAGC
AGTCTCATCTTTCTGACATGCAAGAGGAAGCAAATCGGATCTGGAAGTGGATGGGGGCGT
ATAAATCCCTAGTCCCAGGATGAGACATTGCAAGATTGGAACCACATTTTTAAATAAATG
AAACTACCAGGGTGAAAGTCATATCATCTGACAATAAACTAAGATAACATGCTGTGCTGA
AAGAGAAAATGGAGAGTTTCTAATAACCAAATTATAAAATATATATATCTAGCTGGGGTA
ATAAAATGGAGGCGGAACATGAATATTTCACATCATGGTCGCCTCTGATGCAACTATCAG
CAACACCTGCCAACAGACATGAGTGATGTGGCCATGGCCTGGGGATGGAATGTGAAAAAC
TTCAAGAGGGATGATGATGGGGTGAGGAGAGCTGGGAGCAGGAGCGTTAGACAAAGAGTA
CGCTTACCATCAGGATTCTGGGAGTCAGCATCTTTGGGGATGGTGTACAGATCGTAGGTA
CTATTCTCTAAATTGCTGGCTCTCTGAAGAGGAAAAAAGGAGATTAAAATATTAGTGAGA
TGTATCCAAGATACCAGTTTATTTGACACAGAAAACAGTTCCATTACACAGACAACAATC
GGAAACTACACTTTTATCACCTTTCACCCAGAGGATATTTGAATATTTCCACAATAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved