Cavia_porcellus Locus Mono:286:SNORA70
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:286:SNORA70
Cavia_porcellus
Mono:286:SNORA70
scaffold_169074
SNORA70
1001..1134
1411
ATATACTTAGAAGCCATTTGTGTACTTTTTTGGTGAAATGTATAGGCAAATTTTTTAAC
AATTTATTAACCAAGTTGTCCCCAATTTATTATTGTTGTCGATGTCAATCTAAGATTTAT
TTACTTTTTAATTTCAAGAATAATATATCAACTTTTAGAAAATTCAAATCCCTTTTAATC
TTACCACTCAGAAAACCAAAAGTAGTGATTTTAAAACTAAAATATTCCTAGAAGTAGTTT
AAGTATTGTATATCTAATATGATAAAATAAAACATTAACAGCATCCAATTAAACCAACAG
TTTCCTTTACTTGTGGGTGTCCAGTGTGCAATGGCTACAAACAGCAACCTCCTGAGTAGT
GCACTCAGCCTGTTGTGTGCATGGCTTGCCCTAAGGGACCTTGGAGACAGTGCTTTCCAG
TGGTTGTCATTATCATTGATCTCATACTGTCCCCTGTCTAGACGCCAGACAAGTAAGCAG
AGCTAAGGGAATCCCCAGGAGGGTCGCATGGGTCACACTGGCAAATCATCCAGTCTATTG
ACACCAAGCTGCAGAACAAGGAGCAAATGTTTGAAGTCCTACTCAGGGCCAAGTTCAAGT
TTTCTGGCCACTAGAAAATCCATATCTCAAAGAAGTAGGGCTTTACCAAGCATAATTCAA
ATGAATTTAAAGACCTGGAAGCTGAGAAGTTGCTCATCCTTCATAGTTGTGGGGTGAAAC
AGACCCTCATTTGTAGTCCCTGAGACAAGTATCAGGCCCTGTATTCTTGAAGGCTTCTGT
TGTTCTGTCCTTTCCTTAATCCAGCTCGTCAATAAATCTTGTCTCATTTTAGAAAAAAAA
AAAAAAAAAACAGAAGTGCTGAGTGCATAACAATGTTTTCCTTTGCTTATTTAGGAATCC
ACTATTTTCAGGAAAATTTCTTTGATTTAACATATGCTTAAGAAAACCTTTTATTGCATT
TTATCTATTTTTCCCTTAAAGTTATCAGGGTAATTGTTTACATTTAGTCATTTCATTAAT
TTTATTGCCAAATGAAACATGATGAACATTGCTCCTTAAATATAAATCAGTCCTCTAATT
CTGTCCTCTAAAATTTTCTTCACTTTTCTTTACATATGTTAGGGTATATACTCACTTTTA
ACACCCCTGAACATGAGTGCACTGGCAAATGGTGTTCCGAGTGCGGAGTCCTGCTGACTC
CGCAAAGTTCTCATTTGCTGTGTTCCCCAACCTGCTTTCCACCAAAAGTTACCAGTAGAT
CTCATTCTCTGTACTATCTGACTCTGTATTCCTTATAGCAGAAGCAAATAATAATCAGTA
TAATGCCTTTTTGTGTAATTTAAATTACTGTTTCTTCATCTATAGAGTTTGACTTCCTGA
AGCATTTTCCACTTTTTGTAATTATATGTAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved