Cavia_porcellus Locus Mono:415:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:415:SNORA2
Cavia_porcellus
Mono:415:SNORA2
scaffold_101
SNORA2
1001..1134
2058
TTTAATTCCTGGTAGTCCCCAAAAACCCATGAAAACAAACCAGAAAATTGTATACGGTA
TGTATGCCCTTTAAAAATGGTGATTTTTAAAGAAGTTAGGTAGAAAATAGACAAAAGAAG
TTTAGAAACAAGGCTAGGGGACAAAGGAAAATTACTTGAACTTTGGGAGACTGATGAAGT
CAGGAAGGGAAAAAGGAAGAAATAAAAGCAAGAACATACTAGAACAATGTTCTAGAAATA
ATGTTCACAAGAAAAAATAGAAATAATGTTCACAAAACTAGGAATAATGTTCACACTCAT
ATAAAAACAAGAGCAGAAACTTTAGATACAGCAATTAGACAAGAAAAGTAAAAGGAATAA
AGATAGGAAAGGAAGAAGTTAAACTATCATTGTTTGCAGGTAACATGATACTCTATTAGA
AGACCCCAAAACTCCACCAAAAGATTTTCAGTTTAATAAGCAAATTCAGTAACATAGCTG
GTTACAAAGCCAACACTCAAGAATCAGTAGCCTTCTTGTACACAAATAACAAACTCACAG
AGAGAGAATTCAGGGAAATAATACCTTTTTCAACAGCATCCAAAAAAATGAAATACCTAG
GAATCAATCCAACAAAGGATGTAAAAGACCTCTACATTTTAAACTACAGTACTCTGAAAA
AGAGATTGAAGAGGATGGAGAAAATGGAGAGATATCCCAAGGTTTTGGGTAGGAAGAACC
AGTATAGATAAAATGGTCATATTTCCAAAACTGTTAAGCAGATTCAGTGCAATCCCAATC
AAAATTCCAATAGCATATCTCACACAATTAAAAAAAAATCCTAAAATTGATCTGGAACCA
GAAGAGACCTAGAATAGCAAAGGCAAGCCTGGGCAACAAAGACCAGATGGGGGCATCACA
ATCCCTGACTTGAAATTATACTATACTGGCCCTGAATCAAGGCCAGCAGCTTCCTGATGC
TGTTGTCAAGCAGGAGCCTAAAGAGATAACTTTCTATGGTCTGTTGGCCATTTCAGAACT
TGGGCAGTGAAATGGTCAATTCATTAGAAAGAAACAGCTTGAAACAACCCATCCCCTCCT
GGTGAGCAGCTGCGAGTGGGGCAGGCTGTGTGGTCCAGGATAGGAACCACCGGCGTTTAC
TGGAACCTGTGCCAAGCTTGGACCTGGAGTGCTGAGAAACCAAGCACTCCAGCCCCACCC
CCACCCCCACCATGAGCGTCTGAGTGTGGCAGGCTGTGGCAGCCTAGGATGCCACCGATG
TTTACTGGGACCCATGCCATGCTGGGACCTGGAGCATCAGGAAACCAAGCAACCCCTCCC
CCCATGCCTATTTTATTGATCTTCAATATACATGAATGTATGGACAGCTATTTTGAAGAG
AACGAGAGACTGTACGACAGCCGTTAGTGACTTCCCTATTGTCTGGTTTTGAAGACCTAA
AATGCCTTCCTCATTCTGTTCAGATCAGTTTTATACTATGTTGTTTTGTATGAATTCTCT
ATATGCAAAGACATGGACAACTATTTGGAAGAAAACAAAAGATATAATAGATAGTGAAGA
TCTCTGGTTGTTAGCTTTAAAATTTATGTCTCTTACATTGCTTTCATATGACCTATTTTG
TTCTGTTTTGTTGTATTTAATTTTACCCCCTTTAAAATAAAAATGAAGAAATTATACTAT
AAAGCTACTGTGATAAAAACAATGTGGTATTGCAAAAAAAAAAAAAAAAAAGACCTGAAG
ATCAATGGAATAGATTAGAAGGTTCAGAAACAACTGCAGACACTAAGCTATCTTATCTTT
TTTTTTTTTTTTTTTTGTACCAGGCATCAAACTCATGACCTTGCGCTTGCCTGGCAGACA
GTTATTCCTCTGGGCTAAATCCCTGGTCCAAGCCGCTTTATCTTTGACAAAGGTGTCAAA
CATATTTACTGGTAAAAAGATAGCTTCTTTAATAAATGGTTCTGGAAAAGCTGGCTCTAC
ACATGCTGAAGATTAAAACTGGACCTGTATCTTTCACCATGCAGTAAGCTAAAATCAGAA
TGGGTCAAAGGTCTTAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved