Cavia_porcellus Locus Mono:407:SNORA70
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:407:SNORA70
Cavia_porcellus
Mono:407:SNORA70
scaffold_154777
SNORA70
1001..1118
2118
TAGAACTTCTAAACAGTTTATAAGAATTGATTATATAATGCACAATGTAATGAATAGCT
ACTTTGAAGAAAAAGAGACACTAAGGTACCCAGTCCTGATTCCGTAGTGTCATGATGTGA
AATCCAGCAATACTATTTTTTTTTGTTCAGAGTGATTTTAGTCTGTTTTGCTTTGTTTAA
CTTCAACATACATGAAGGTATGGACAGCTATTTTGAAGAGAACGAGAGACACTATGGCAG
CTATTGTTGACTTCCCTATTGTCTAGTATTGAAGACCTAAATTCCTTCATCATCCTGTTC
TGATCAGTTTTATACTATTGTGTTTTGTATGAATTCATTGTATGTGAAGATATGGACAAC
TATTTGGAAGAAATGAGAGACAATATGATATACAGTGAAGATCTCTGGTTGTCTTGCTTT
GAAATCTGTGTCTCTTTGTTTTCTTTTCTTTTCTTTTTTTTTTTTTTCTTTTTTTTTTTT
TTACCGGTACCAGGGATTGAACTCATGACAATGTGCTTGCAAGGCAGGTGCTTATGCTGC
TGAGCTAAATCCCCAGCCCTGTTTTCTTATGATCTGTTTTGTTATGTTTAATTTTACCCT
CTTTAAAATAAAATTTTAAAAAATCAATAATATTGATAAACACCTGGAATGATATTTGTA
TAATACAAATCTGATAAAAGACTTCTATCCAAAATATATCACAACCCAATAAAGATAAAC
TAATTTAACAATAGACAAAAGATTTGTCACCAAAGCAAATGCACAGACAACAGGTAAATA
TATAGAAGAATGTTAGCATAATTAATCAACACAAGAGGTTATCACACCTCACTCACTCTA
GACTAAAAACTAGAAAGATTGACCACACCAATCACTCGCAAGAATGTAAGAGAACTGGAA
TTCTCATGTAGTGATTGGGAAATGGTATAGCAACCACTTTGGAAAACATAGTATCTTAGT
ATCTGAAGAAGTTAAAAATATGCTTAAAAAATGTTAAGCCAAGACATTCAACAAGTCCAG
AAGAATGTTTTTGTACTGTGTTTGCAAACAGCAACCTCCTCTGTAGTGTATGTAGCCTGT
TCCTTGTATTGGCTGCTGGAAGGGACGTTGGAGACAGTTTCCCAGTGGATGTTTGAGTGT
CTGATCGATCTCTTGCTGTCCCCAGTCTAGGCTGCAGACAGGAATGCGGGGTGCCTTCAG
GAAGCCCCAGGGCACAGTGGTGAGGGTTCACATTGGACAGGTCATGTCCATGTGCATTGC
AGAACAGGGAACATCAGATTGAGGCCCTACACAGGGCCAAGTTCGAGTTCACTGGCCACC
AGAAGATCCATGTCTCCAAGAAGTGGGGCTTCAAGCTCAGTGCGGATAAATTTGAAGACA
CGGTGGCTGAGAAGCAGTTGATCCCTGATGGTTGTGGGGTGAAATACATCCCAATTGTGG
TTCCCTGAACCAATGAAGGGTCTTGCACCCCTGCAGCCTTCCACTGTGCCATCCTTGCCT
TTAAAACAGTTAATCAATAAATCTAATCTCTGCCCCCTCAAAAGAAGAATGTGTATGAAT
GTTTACTGCAGGTGTATACATAATAGCAAAAAGTTAGAGGTAATGAAAAACTTAGCAACC
AGTGAGTGGATTAAAAACTAGAGTATATGAGGAATTACCAGTCGGCAAACAGTAAGAAGA
TAAAGGTAAAGAAGGAAAAGGAGGAGGAGGAGAAGAAGAGGAAGGAGGGGAGGAGGAGGA
TAAGAATAAATAAATCTCAAAATAATTGTCATGAGAAAAAGACCATGTATGTATATATAT
GTATACACACATTATGTCTCTTTATGCTTCTATATGTATATATGTAATCATATATAGGAT
TCTGCTAGAATAAAGTTCTAGAAAATAGAAATCAATCTACAATAGCAGAGGCAGATTGAG
CCTGCCTAGGGGGTGTTTGACTGTCAGGGAGGAGCAGGAAGGAAGGATAACACAGAGTAA
TAAGAACAATTTTCAAAGCAATGCCTGGTTTTGCATGTGTATGCATATGTCAGAAGTACA
TTTTATCACTAAAAAAGAAGGCTCAAAGTCAAAGAAGATGTACTAAGCCAGTTGAGTTCA
GTGTCGCTGATAAGAAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved