Cavia_porcellus Locus Mono:369:SNORA28
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:369:SNORA28
Cavia_porcellus
Mono:369:SNORA28
scaffold_253907
SNORA28
1001..1126
2126
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAACACTCTGTGACAG
ATTATGAAAATAGTCTGTCACAATTTTAGCTTGCTATAGCAGGAAAGTCTAACCTATTTC
GGCACTCTCCTTTCTGTGAGACAAGCCGTTACATAGACTGAAACAAGTTAAAAGAAAAAA
ATAGCAAAGGACTATGAGAAATCAATCCAGCACTTGCTAGGTGATTCAATGAAGAATAAC
ATAAGATTAAGTGGAGTCAAAGAAAAAAGAAGGAGATAGTACAAGCATAAAAAGTCTGTG
CATAAGCGTTATGGCAGAAAACTCCCAAGCAGGGGTAAAGAATTTGACATACAGATAAGT
GAGGCATATAGAACTCCAGTAAGCCATGATCAAAAAAATCTACACCAAGGCATGTAATGG
ACAAGATTCCAGAAATGTCCTGATGGAATGGACAACTATTGTGAACATAAAAATATATTC
TATGGTAACTATTATTGTTTTCCTGGAATCCTGCTCTGAAGTTCTGTACCAGTTTTGCTG
CATGGTCTTGATCGGCTTTGTTCTGTCTTGTTTTGTTGGATTGTACTATCTTTCAAATTA
AAAAAAGAAGAGAAAAAAATTTCTGGAATGCAACACAAGCCTATTAAAAGATATTAAAGA
AAATAAACTAATCACTAATCCAACAATATGCTGCATACAAGAAATACATTTAACTCAAAA
AGAAATTCATAGACTGAAAGTCAAAGAATGGAAAACAATACTCTGTGTGACAGAAACCCA
GAAAAAAGTAGGGATAACTGTTCTATTTGCAGAGTAGATTTCAACCAAAACTGATTAAGA
GTGACAAAGTGTTGGGAGCCGCAGCCCCGAGCCCGGTCGCCTCACTTGGCGGACGTGAGG
CCTGTAGTAAAGAGTAAAGCCTGAGGTAGATTACCCCTCCCATCGAGCACGTTAGTTTCC
TGCTTACCGCGTAAGCAACCTGCTCAACAATATAGTCTGCCTGGCAACTGATGATGTTAG
CCAATCAGCTTGCCTTGCTTACTTTAACATGATTGGACACTGTATCCGTATATATACTGG
TGCCACCCCTGGGGGGGAAGAAGAAGCCCGGAAGTAGAAGCCCAGAAGGAGCCGCGGGGA
GCGGACCAAAGGAGGCTTCGGCTGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved