Cavia_porcellus Locus Mono:76:SNORA4
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:76:SNORA4
Cavia_porcellus
Mono:76:SNORA4
scaffold_196578
SNORA4
1001..1136
1991
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTGGTCGAGTCCCCCAGAAAACTTGGTCTTAATGTTCT
GGACAAACACCTGTTCATTCTGATCAAAATATAGCTCCCAGAGATAAAAACAGACCTGTG
CAAAAAAAAGAAGAAAAAAAAAGTAAGGCACCAGGTGAGGTGGTTCATACCTATAATCCC
AACACTTGGGAGGCTGAGGCAGGAGGATCATTGCGAGTTCAAGACCAAAAGTTAAATTTC
GAGGGTAAAGTTTTTTAATAAGCTTTACCAATCTAAGCTCTTTGGGAGGCTAAAAGACCA
CACTCCACAGTGAACTATACCACTCAGTATAGTTCATTACTATTTTGTGGCTACATTACA
TAGGTAATCCAGTTTTTTTTTATCTGATTAGAGTTTTGAACATACCTCTTTGTGCTTCAG
GCTCGTGGGATTGATGTGCAACAAGTGTCTTTGGTTATAAACTATGATCTACCTACCAAT
CGTGAAAACCACATTCACAGGAGTCGATAGCAGCAGTTGATGATGAGATGGTGCTCAGAA
GCGGCATTGACGTAATTTAGGACGTGGACTCATAAGTGAAACAGCACACTTTGAATAAAG
AGGGAAATTGGCAGAAGGGGTTGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACT
GAAGAAGACAAGAGGATTCTTCATGACATTTAGACTTTCTGCAATACTTCAGTGGAGAAA
ATGTCCATGAATGTGGCCAACCTTATTAAATTCCTGGGATGAGAGTTTCGAATGCAGTGC
TCACTGTTGCTGAATAGGCAATCACAATGTGCATTGTGCTGCTTTGGGAATTTATGAATC
TTGTCTCAATGCTAGTAACAGTTCAGAAATACAGATTTTGATAGCAAAGCGACATTAGTT
GTGAGTTCTTGTGAGGAAAGTCATTGGCGTTATCCTCTTTAGAGTTAGACTGTTGGGTGG
ATATAAAAAAGATGGGGTCTGTAAAATCTTTCTTTCTTAGAAATTTATTTCCTAGTTCTG
TAGAAATGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTACGGACAAAAAGAT
ATAAGTGCTGTATAAAATCAGCCAATTAGGTTAAACTAGCATATCTGCCTTTATTGTGTT
TGTCTTTAGCCTGGATAGAAAGGCCTTTAAAATTGATTTTTTTAAGAAAGCATTTGAATG
CAAAAAAAAAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved