Cavia_porcellus Locus Mono:148:SNORA70
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:148:SNORA70
Cavia_porcellus
Mono:148:SNORA70
scaffold_117103
SNORA70
1001..1117
2117
CTGATGATCTTTTATGACAACATCACTTCTGCTGCATGCCTGTGGTTTACAAAGTAGTC
ACTAACTCATCCCAGATGCATGGAGATGGGACACAGATACCACCTTTTGATGAGAGAAGT
GACAGAGAATATACAGGTATGTTTTAAAACTGCCACATAATATATTAAGAATCTAAGGCT
AAATGCAAAAACACAATGTAGAATTGCAGGTATATTGTGATTGAAGATTCATAGGAGTGG
ACATACAGAAGGAAAAAGTGAAAATTTTTATAACTCATAATTAAGAATGATTTTCTCCAT
TTATTTTATAATAGAAAAGTGATTCTATGTTTTGCATTACCAGCTCTGCTCCATTTTTCC
TCCTGGTTTATCTTGAGGGTATCTGGGAGACTGGTTTTGAAGCAGGTTTGGGGTAAGACA
GGGCACTGACAGTATGACCCTCTGGTCATGGAGGTGGCCCTGGATGTGGTGAGGACAGAT
TGAACTGTGGTTTCTGGGATTTGACATGACACTTCCAGGACTGTCCCATTCAGTCCCAGG
TTGAAGCCCACAGTGTCACCTAATGACTTAAAAGGGCAAGACCGCCAAAGCAGGTTTTCA
CCCTTGACTGTATCCTGTTCTTTTTGCTCCATAAAACAACAAGAAAATTTGCCAAGTGGT
GCCACTGAACAGTAGTGTACATCTGTCAGAATAGAACGGGTGCACGTTCAGTCTCCCAAG
CGCTGTGAAGTCACAGCGCATTTGCCTTCCACACTCTGGTATCCAGAGAACTTTACTGAC
CTTCTTGTGCTCACATAGCAAGACTTGGGCCACATAGGAGGCCTATGACAGACTGAAGTG
TGTCTCAAACCTGCACCACTCCCTGAATCACGGATTGAAATCCTCCCCCCAGTGTGACTG
TATTTGCAGATAAAGCCTTTATGGAGGTCGTTGAGATTACATGAAGTCATGAGGCTGAAA
TGCTAATTCAGTAGCACTGGTGATCCGATGAGAAAATGAGACTGCAGCCTAGTCCAGCTG
GGCTCCCTGCCTTGCAGAGGTCTCATGCACAGTGGGTAATGGCAGTGAATGCAGCCTGTT
ACTCCTGTGGGCTGCTCTGAGGGACCGCAGAGGCTGCCTTCCAGTGGGAGTTCATGCCTT
TGATCTCTGTTGTCCCCAGTCTAGGCTCCACACAGGAAAGCAGCACCTTTGGAGGCCCCA
GGGGATAGTTGCCTGGGTTTAGGGTGACCAAATCATCACATCCATCCACATCAAGATGCA
GAACACGGAGCATGTGATTGAGATCCCCCATGGGGCCACATTCAAATCCCAAGTGCCAGA
TAATCCACATCAAAGCAGTGGGGCTTTTCCAAATTTAACATGGGTCGGTTTGAAAACATG
GTGACTGAGAAGGGACCTGTAACAGATGACTGTGGGGTCACACACATCCCTAATTGTGGT
CCCCTGGGTGAGTGGTAGGCCCTGCGCTCTTCTACCCATTCTTAGTGAAGCCCACCAGTA
AGCCCACAGCTTTCCTGTCAAAAGCTGAGACACCAGCCATCTCTCTCTGTCTCCACCACT
GTCTGTTACTCCACAGAGGAAAGGCCACATGAGGACACTGAGAAAAGGCAGCCATCTGCA
AGCCGAGGAGAGAGGCCTTAGGGACAGTCAGGCCTCCTCACACCTTGATCTTGGATTTCT
GTCTTCCAGTGCTGTGTTGAGATAAATTTGTGGTGTTCAAGTCAACCAGCCTTTGGTATT
TTGTTGTAGCATCCCGAGCTGATGAGACAAAGCCCTGTAGACTGGGCCCTGGTGCTCTGT
TGACCCTCTTGTTTCATTTGTAAAGCATTTCTTTACTTTCTGGTAAGGATGGTCTATGTC
ACGTGATGTTTCCTGTCCATGGTACAGAATGAGGGTCCCCAGAGATGACCGCATCCTAAA
CCTTCAGACCCAAGACTCTGTGGCCTTACTGGTGTACAGCCCAGCATCTGTGCCACCGCA
TGAAATCGCCTCCCATGAGGACCAAGGAAAAATGTGAAAAGCAAACGTGTAATTTTGCCC
AATGAGGAAAATATTGAAAAGAAAACTTAGCTGACATTTGAGTAAATGAAGAGCTATTTC
TAGGATGAGAAGGGCAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved