Cavia_porcellus Locus Poly:snoR38
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:snoR38
Cavia_porcellus
Poly:snoR38
scaffold_193
snoR38, snoR38, snoR38
1001..1073, 2443..2521, 3046..3118
4118
TTTCTCAGACCTGAAGTGGCAGTGACCAGCCCGATCTCCTTACAGAGTTGAGAGGGAGG
GGGTTGAGCTTCTGGATGAGAAAATGCTTTCCAGAAAGTGAGGTTTTTGGCTTTGTTTTG
TTTCTGTTTTTTGATTTTTTTTTTGATTGGAGAAAACTGAAGCCAGTTTTTGGCATCGGA
GAGCTTCTGGAAGACAGAGTCCTTGCACCCAGCGCGACCCAGTGCACCTCAAAGCCATTC
CTAGTTAAGCATTTAAGCCTTGGGGCTTGGGGTCTCCCCAGCCCTCGCAGAGGCACTCTG
ATCGTGGCAGTTGTTAGTGTCATTATCTGGAGTAGTAATGTGTGAATACATAACACGAGC
ATGACCCAATTAGCCATTTTTGTTTAAGGACTACATTTATTTAATGAATGGCATTATAGA
TTCTGGAAATTCATGTCTTTTAATAACGAACCTTTTTTCTTCCCTGAAGACCCTTTGACT
TCTGCAAAGGCGAGTTCAAAAGAAAAGGAGACTGTCTGGGATCTAAGTGTTCCCCAAGAA
AGCAGAAATGGTGTAATGGTCTATCTGTGGTTTACATTTTGTTCTGAAGCTAAGTTCAAC
TGAATGCATGCATGCTGGTCTAAGTCCATTTAGGGTAAGAACTCTGCCCAGAATTTACCA
TTCTAATTCTTGAATGTTAAAAATGGAGGGTGGGTGCTGGTGTTGCTTGGGACCACTAGG
TGTCACTGTTTAAATGAAGCCAATTTGAATACCACTGTGTAAAGGATGAAAAACGGAGGA
GTTTGGCCTCACTATGTAGCCGGGGCGGGCCTCAAACTCCGCTGTGATCCTGCTGCCTCG
ACCCCCTGAGTGTTGGGATTGCAGGTGTGCGCCACCACCCCCAACCTTTTTTTTTTTTTT
TAATTTGTTCTTTTGTAGCATCCAGAAATAAAGACCTGTGCACTGAAAAAACAAAACAAA
CAAAAAAACGGATGAGTTATGGTTGGCTTAGGAGTTAATGGTTGAGCTGAGGATGATTTA
AAGTTATCCCTGTCTGAAATGCCATCTTGTGGAGTCCTGATTACTGAAGCTCAACTTTTA
ACCATGTTTTGAGAATAAATTCCTTAAAGGGAGTTCATGTTAGAGTGAAGTTTGTTTTCC
TTGTACATTAAAGGTGCTGACTGTGGACTTTGAAAGAAATCATATGAAAATTCATCTTAC
AGTGTTGAGATGAAGGATCTTCATGATGAAATTGCCATAAATAGTAAGATTTTTAGCTAT
TTCATAGAATTCCATAGGTTATTGTCCGTCCCCTGTAAGTAATGGTTTGTTCAATTTGGA
AATGGGTGAGTCACAATTGTGATGGCCTAGATTAGGGGAGTAGTACAAAATTATTTCTGT
TTAGGTAGATTTTTCCCTCCACTTGGCTGTTATGTAAGTTATAAAACAGGCTTAAGGGAG
TGGTCTTGCCCACAGTTACACAGTTGATGTTAGGTGAGATCTGTGGTTTAGAACTGTAGA
TGAGAGGGTGCTGCTCCTAGCACCTAGTAGGTACAGAATAACCTACAGCCTTGAAAGGTC
CGTATTAGACTAAAGATCTAAGTACCAGCATTGGCCTGCTACCACATGATGCCATTAGTA
CCTCGTTTGCTTTTTTATTTGTAGTAACAGTGGTTTCCAAACCTGGTTATATGTCACAAT
CAACCTACAAAGTGTTGAAGTGTATGCATTCCTGGGCTACACTTAACTGCCACAGAGGAG
AATGGCTTTACTTTGAAGCCCAATAACCAAGACCAGACATGTAGGAGCAATTAGTTGATC
TGATCTGCATTTAGCTCAAGGATTTTATTATAGCAAGATTATAGCGCTGGCTATTTTTAA
GTAGCTCTTGAGGCAGATCTCTAATCCTCTATTTTTAAAAAAACTGACAGCCCTGTGCTT
GTTCTGCAGAGTAGTTTTATGTACTAGTGGATGCAGGAGAAGTGAATGACCTTTGTGTAT
AGTGTTGTCTCTTGGCAGGAGATGCAGTGGGTGCAGCTGGCCTTCATTAAGCTAGCTGAA
GTGATGAGTGATCTGTACTATCCTGGGCATTTTACTGCCTGCTAGAATGCATTTTGCCTC
CTGAGCTCTCAGACACTGCTGAGTGACCCTGTCTTAAGGATAGGCACTATTCATGTGCCA
AGGGTGCAGACATTGGGTACATCTAGACATTAGATAGAAAGAAATAGCTTTCGCTAAAGA
GGGAAAACATCTGAATAAAAGGTTTCAGGGGTTTAGCTCAGTCAACAAGCACCTGTCTGC
CTAGCTAGTGTGAGGTTGATCCCCAACCCCCCCCCACACACATTTTTTTTTTTTTTTACA
GTAAAGGTTGGTTGAGAGTCACATGAGGAAAATAAATCACAATTTGTTAAGAAAAAATAG
TTTGCATATATTCTTGGGAGTGTTGTCTGATGCAGAGTGGGAACTGAGTCTGTGATGATT
AAAGTTATCCCTGTCTGAAGGCAAAGGCCTTTCTGTGTGGATTGTGGATCTCTGAAACTC
AGCTTCCCATTTGCTTTCTATAAAATTCAGCAAGATTTTAAAAAGTACTGTGTATATCTT
CTTAAGTAGGTGTTTTCACATATCTCGTCCTTGACAGGTACATTCTCGGTCTCAGTTTCT
GAGGCTCAAAAAGGATCCTTGGGTAGCTGCACTTCGTTGGCGGGCCCGGACCCAAAATGT
ATCATTCATGTAAGCAGAGAAGGCCTGAGCAGCCTTGAGTGGAGTGTTAATTCTTTTTGC
ACGCCTTGCCCTGCTTTGAAGGCTGTGAAAATTGACTGGTAGACTTTAACCTAATTTTGT
TTTTGTTTCTAGGTTGTTTTTTTTGTTTGTTTGTTTGTTTTTTTTGTATTTTTACCGGTA
CCAGGGATCGAACTCACGACCACAGACTTGCAAGGCATGCGCTTATGCCGCTGAGCTAAA
CCCCCAGCCCCGTTCCTAGGTATTTGTGATATGAGACAGTGCTGAACTGCTTTGCAGGCA
TGCGAGAGCTCCCGATAACTGTAAGTTTTGTGTCCCTAAGAAGCCCCCCAATCTATGATG
GTTAATTATCCCTATCTGAAAATCTCAGCTGAAGGGAAATAATTCATTCTGAGGTTTAGG
GGGTGGCTGCATCCTCCAAAGGAAGTTCAGGCTCTATCAGGGATGGAGCTTGTGGCTCAG
GGAGTTGCGTGTGTCTGGCTGAGGCCCCCATTATAATATGTCCTTCTGGAGCTTAAAAGC
CAAAGGTCTAGTTGGCCTGTTAATGCCAGTCCCTTGATTTATGCTCATTGTGGAATGAAA
GAATTATTTGTCATGTATTTTGAGAAAATGAATGCTCTTTTGAAACTGATAGGGGAATGT
ATAATGCATGCCAGCTTGTGGCAGTGAGAATGGTTAATGACTGTCCTTGTGTTCAGAGCA
ATGTCCTGACATTTAGGAAAGAGGGTACCATGGCCCTGGCAGAGCTGTTTGGTTTCCAGG
AGCTCCCATGTGTAGCTTACCTTCTGTCTGAATAGCATAGCTGGCCCAGAGCTGCTGCTT
GGGTTCTAAAAACTGGCACATGAGCAGGAAAGAACCAAAGTGGTGATGGGGAAGACGGTG
TCTTCTCACTTAAATGCCACACTTGAAATGGACACAGATTACCCCTCTTTCCTGTTGAGA
TCTGCAGCTGTTTGTAGGCTCCTTGCATTTAAGGTCCTTTTTTCCCCCTACTTTCTTTGA
AGGATTTGGGGTGAGATTTGATGAGCTTGGGCACTGACTGCAGTAGCTTATAACTTGAAA
ATAAAGCAAAGTAAATTGGCGGGTTAGCAAAATGAGAAAGCTCATTGTCATCATTGACTG
CTTCTGAGAGCAAGCGTGATTGTTCTGTTGGGCGCAAGTAAACCCTAAGGTTCATGTTCA
GAGTGAGTTAAATATAAATATCTGTGCTGCTTACTGGGAATTACTTTTTCTTACCACTTG
GCAAAAACTTTACCCTTAGATGCCATCCTTAAAACTTGTCATCTTGGACCTTCCCCACCC
TGCACTGAAGCTTTTGATCCTGCCCAGTTGTGGTCTCAACACACACATAAATAATGTCCA
TAAATAAAGGTTACATTGAGTCCTAGACTGATGGCCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved