Cavia_porcellus Locus Mono:483:SNORA5
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:483:SNORA5
Cavia_porcellus
Mono:483:SNORA5
scaffold_182807
SNORA5
1001..1120
2120
AACATTATATAGCTATGCTTCTTCACCCCGGATGTGAGTGGCACACATCGAAAATATGT
TGGTAGCCTGAGTGGAGTACACAGCTCACTGGGAAAAGGAGCCTGACTCTTGTTCTTGAC
AGAGGCTCACTCTTTGACTTGAATTAGAAATACTGGTCTCATAGCCTTCCACTACAGAAT
GTTCAACTTTTGCAGCACTGCACCCTTCCAGCTTCCTGANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAG
GGAGGTTTTTCTAACATATTGCATAATAACATTATCCAAGACATTTATGTAAATACAACA
AAAACTAAGCCATTTCAGTTCTTTAAAAGACACAAAATCTCTGCAGCTGTGTCAAAATCG
GGGCCCGCCTCGCATGGCAAGCACCAGCCCAGGAGGCTGCCACAGGAACACTGGGCCCTG
CGCCCCTTGCCGGGGCAGGGATTAAAAATCAAAAGACACAAAAATCTTTAAAACAGAGCT
TGATTTTAAGGAATGAAAAAAAAAATCAGATCATCAATATCCTAAGTATATGGCAAGTAG
GCTAATAATATATAATTATATTAATGTATGCATAATAAAATGTGCAGCCAGGTACAAATC
AGTCTTATTTCCAGGAAAAGTGAAATATAGTTAGCAATACTGATTTTCCCTTGAAGTATT
GACCTGCTTGAATGAACACTGCACAGCTAATGAGAAGGTGCTATCCTCCAAGAAATTCTT
ATCAGAGATGAAAAAGGAATCTGCCAAAACTTATAAATAGTTAAGTGGCTTCTTTCATTC
CTGACCCATGATAAAATGTGACAGATTAGGAGAGAATCTGAATTAGATCTCTAGTGACTT
TGAAGTGTTTGGTTGAAGTCTGAAGAATTTGGGGCAAGAAAGTTGGATTGTGCAAGTGGA
GTTGTCACCTCTTGATCTGATTGAAAAATGCATTTTATAGAAAAAAAGAGGCATTTGAAA
TTGAGTCTATGCAGATGGTGTTAAAAGATAAAGTATTCTTCAAGCCATAGTTTATCATTT
CAAAGTGATAAATGTCTGAGAGGAAAACATTTCATGAAAAAATGAAAAGAACTAAAATTT
AGGCTCTGTGTCACATGCTTGTCTCCATAGAACATTTCTCAATTTTTTCCAGTTCTCCTC
ACTATTAAGATTGCTTTTTGCATAGAATGTTAAAAGATATACTTTTGTATCTGCAAACAT
CACCAAAATAATGATGAAATGAGTTGATGGACTATACCTTCTGTTGTACTCAGGGTTTGC
AAGGAAAACAATTTAATAAAGGACACAAAATTTTTAGAATTATTTTATAATAGTCACCCA
AAAGTCGAACACAAAAAGTGCGGGAAATATGTTCACATGTTAAAGACCCCAAAGGATCTA
TCTGAGGGCCTGGATCCCATGGCAGTGTCCTGCATGAGTCAGGTGAAGATCTAGAGCTAA
TGACAATGTCTCATGCAAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved